The sequences for the shRNAs against rat STAT3 were ACTGGATAACTTCATTAGCAGAATCTCAA

for the shRNA-1 and TTCTTCACTAAGCCTCCGATTGGAACCTG for the shRNA-2. The sequence of the control, noneffective, shRNA used was GCACTACCAGAGCTAACTCAGATAGTACT. The experiments on acute slices were performed on 400 μm thick parasagittal hippocampal slices obtained from juvenile (13- to 17-day-old) Wistar rats, as described previously www.selleckchem.com/screening/anti-diabetic-compound-library.html (Peineau et al., 2007). Hippocampal organotypic slices were prepared from 8-day-old Wistar rats, as described previously (Bortolotto et al., 2011 and Jo et al., 2010). Procedures involving animals and their care were conducted in conformity with the institutional guidelines that are in compliance with national (UK animals (Scientific Procedures) Act 1986 and D.L.n.116, G.U., Suppl. 40, 1992) and international laws and policies (EEC Council Directive 86/609, OJ L 358, 1, 12 December 1987; Guide for the Care and Use of Laboratory Animals, U.S. National Research Council, 1996). In all electrophysiology experiments, the

CA3 region was removed. Extracellular and whole-cell experiments were performed as reported previously (Peineau et al., 2007). Whole-cell voltage-clamp recordings on organotypic slices were made from transfected CA1 pyramidal cells at 6–11 days HDAC inhibitor in vitro and were performed blind with respect to the transfected plasmid. Two stimulating electrodes (test and control input) were placed in the Schaffer collateral-commissural pathway and stimulated at

0.05 Hz to record AMPAR EPSCs (Vh = −70 mV). To measure NMDAR EPSCs, neurons were held at +40 mV and the EPSC amplitude was measured 60 ms following the stimulus. NMDAR-LTD was induced using a pairing protocol (1 Hz for 6 min, tuclazepam Vh = −40 mV). Access resistance was monitored constantly and neurons were discarded if this varied by more than 20% during the recording period. Data were stored and analyzed using the WinLTP Program (Anderson and Collingridge, 2007) and are presented as mean ± SEM. For chemically induced LTD, whole hippocampal slices (without CA3) were treated with either 20 μM NMDA for 3 min, 100 μM DHPG for 10 min or 50 μM carbachol for 10 min. For LFS-induced LTD, hippocampal slices were stimulated (900 stimulations at 1 Hz) with two electrodes placed in the Schaffer collateral-commissural fibers. The stratum radiatum surrounding the stimulating electrodes, enriched in CA1 dendrites, and the stratum pyramidale, enriched in CA1 cell bodies, were then microdissected within the next 10 min and washed in a cold buffer. The nuclei were isolated by centrifugation from the stratum pyramidale portion. The samples were then lysed and western blotting was performed.