The molecular and serological investigation of Feline immunodeficiency virus and Feline leukemia virus in stray cats of Western Turkey

Dilek Muz a,*, Hüseyin Can b, Muhammet Karakavuk c, d, Mert Do¨s¸kaya c,
Hüseyin Go¨khan O¨ zdemir e, Aysu Deg˘irmenci Do¨s¸kaya c, Esra Atalay S¸ ahar b, Bayram Pektas¸ f,
Mehmet Karakus¸ g, Seray To¨z c, Yusuf O¨ zbel c, Adnan Yüksel Gürüz c, Mustafa Necati Muz h
a Department of Virology, Tekirdag Namik Kemal University, Faculty of Veterinary Medicine, Tekirdag 59030, Turkey
b Department of Molecular Biology, Ege University Faculty of Sciences, Bornova, Izmir, 35100, Turkey
c Department of Parasitology, Ege University Medical School, Bornova, Izmir, 35100, Turkey
d Odemis¸ Training Collage, Ege University, Odemis¸, I˙zmir, 35400, Turkey
e The Protection and Development Union of Izmir Bird Paradise, Izmir, Turkey
f Izmir Atatürk Training and Research Hospital, Department of Microbiology, Yes¸ilyurt, Izmir, Turkey
g Department of Medical Microbiology, Hamidiye Faculty of Medicine, University of Health Sciences, I˙stanbul, Turkey
h Department of Parasitology, Tekirdag Namik Kemal University, Faculty of Veterinary Medicine, Tekirdag 59030, Turkey

A R T I C L E I N F O

Keywords:

FIV FeLV
Serological survey Molecular survey Stray cats
Turkey

A B S T R A C T

This study aimed to investigate the Feline immunodeficiency virus (FIV) / Feline leukemia virus (FeLV) infection prevalence among looking healthy stray cats in Western Turkey by serologic and molecular-based tests. A total of 1008 blood samples from the stray cats were used in this study. All samples were tested for FIV antibodies / proviral DNA and FeLV antibodies / antigens / proviral DNA. The genetic characterization and phylogenetic analysis of FeLV and FIV were carried out in this study. These cats also tested for Leishmaniasis and Toxoplasmosis previously. FIV Ab and proviral DNA detected in 25.2 % and 25.5 % of samples, respectively. FeLV Ab, Ag, proviral DNA positivity was in 45.2 %, in 3.3 %, in 69.7 %, respectively. The molecular detection and phylo- genetic analysis of the current FeLV pol gene and FIV gag gene performed. The molecular characterization for the pol gene of FeLV (enFeLV and exFeLV) among Turkey’s cat population was reported for the first time. The exFeLV pol sequences closer to the FeLV-A genotype, and the enFeLV pol sequences overlapped with other enFeLV. The current FIV gag sequences were clustered within the subtypes A, B, and C. The findings revealed FeLV subtype A and FIV subtype-A, subtype-B, subtype-C circulate among Turkish stray cats. Single and multiple co-infection positivity was found higher compared to previous reports.

1. Introduction
Feline retrovirus infections have threaten feline health with their immunosuppressive, oncogenic effects and causing deaths. The latent carriers may give an insufficient immune response to other pathogens when faced with immunodeficiency risk [1–3]. Feline leukemia virus (FeLV) induces neoplasia, aplastic anaemia, and bone marrow abnor- malities resulting in poor immune responsiveness or immunodeficiency [4]. The virus can spread via close contact, mutual grooming, sharing equipment, foods, scratching, biting and transfer vertically to the next generation [5].
FeLV is a gammaretrovirus, belongs to the Retroviridae family.

Endogenous Retroviruses (ERVs) are an integrated retrovirus copy within the host genome and reported in different mammals host, including domestic cats. A few retroviruses described in the cat genome mostly called endogenous feline leukaemia virus (enFeLV). EnFeLV is a proviral form that can evolve to Exogenous feline leukaemia virus (exFeLV) in infected cats as a copy of exFeLV integrated into the host genome [6]. EnFeLV can play role in emerging of exFeLV subtypes and exogenous retroviral infections. The nucleotide level differences between exFeLV and enFeLV have been reported as insertion/deletion, frameshift, recombination, and approXimately 86 % homology rate [7,8]. FeLV-A is a commonly reported subtype in FeLV infected cats [9]. Other subtypes are less common, and they often emerge following FeLV-A infection

* Corresponding author.
E-mail address: [email protected] (D. Muz).

https://doi.org/10.1016/j.cimid.2021.101688

Received 9 March 2021; Received in revised form 11 June 2021; Accepted 27 June 2021
Available online 29 June 2021
0147-9571/© 2021 Elsevier Ltd. All rights reserved.

through the recombination between exogenous and endogenous viral sequences during FeLV-A infection [10].
Detection of free viral p27 antigen in blood samples is preferred to determine antigenemia in FeLV viraemic cats. The point-of-care tests used for this purpose having high sensitivity and lower specificity, and may cause false-negative results. It needs confirmation by PCR tests targeting viral RNA/proviral DNA [11,12].
The FeLV infection is described clinically and epidemiologically into several stages [2,13]. The progressive infection poses a poor prognosis and considerably characterized by antigenemia, high viral/proviral loads, and lack of antibody response, persistent viremia, resulting in clinical disease leading to deaths in a few years. The regressive infection develops following primer viremia, and defined by the antiviral immune response, persistence of proviral DNA, and lacking antigenemia. [14]. High titer neutralizing antibodies without antigenemia and proviral integration defined as abortive infected, and their prognosis is consid- ered good [2,13].
Feline immunodeficiency virus (FIV) is another retroviral cat pathogen that FIV belongs to the Lentivirus genus of the Retroviridae family and can integrate into the host genome [15]. The viral genome includes the accessory gene and the main three-gene (gag, pol, env). The classifica- tion of seven FIV subtypes in the phylogenetic based studies has focused on the env and gag gene regions [16,17]. The FIV infected cats may not be symptomatic, but the acquired immunodeficiency syndrome may predispose the cats to clinical disease. The detection of neutralizing antibodies and the viral/proviral genome is preferred in FIV diagnosis [18]. After virus exposure, the antibody test may result in negative within the first 60 days. Highly conserved gene regions such as viral gag gene are prefered in PCR diagnostic assay [19].
Cats may survive co-infected with FeLV, FIV. The risk factors like
multi-cat environment, shelter and seconder infections threaten cat health. That is why should all cats’ feline retrovirus infection status be known, as suggested by the American Association of Feline Practitioners [20].
FeLV/ FIV infection prevalence has reported at various rates [21–27]. The infection prevalence is considerably higher in multicat environments and stray cats. The FeLV and FIV infections have been reported previously from Turkey [28–33]. This study investigated simultaneously, the genetic characterization, serological diagnosis and molecular detection of FIV and FeLV infections in “looks healthy” stray cats in Western Turkey.

2. Material and methods
2.1. Samples
A total of 1008 female stray cats admitted to a neutering unit from 13 districts of Izmir (Balçova, Bayraklı, Bornova, Buca, Çig˘li, Gaziemir, Güzelbahce, Karabag˘lar, Kars¸iyaka, Konak, Narlıdere, Seferihisar, Tor- balı) in Western Turkey were blood sampled for the current investiga- tion. (Fig. 1). Health status of tested cats evaluated and any signs releated to FeLV or FIV infections was not detected. The samples used were previously screened for Leishmania and Toxoplasma infection [34, 35]. All animal procedures achieved under the Institutional Animal Care and Use Committee (IACUC) of Ege University instructions and approval
for animal ethical norms (Permit number: 2010—72).
2.2. Serological Testing and Antigen Analysis
All serum samples tested for anti-FeLV and anti-FIV antibodies using commercial enzyme-linked immunosorbent assay (ELISA) kits. ELISA kits analyze FeLV (BioproniX FeLV gp70 Ab, Agrolabo, Italy) (sensitivity 96 % and specificity 100 %) and FIV serological status (BioproniX FIV, Agrolabo, Italy) (sensitivity 98.8 % and specificity 97.9 %) were per- formed according to manufacturer’s instructions.
FeLV antigenemia in serum samples detected with a combo ELISA SNAP kit (BioproniX FeLV/FIV IC, Agrolabo, Italy). This kit detects FeLV p27 Antigen (sensitivity 100 % and specificity 95 %) and FIV antibodies (sensitivity 98.5 % and specificity 99.7 %).

2.3. Molecular Analysis
2.3.1. Nucleic acid extraction and PCR
Total DNA extractions from buffy coat were performed using a commercial kit (Qiagen, USA) according to the manufacturer’s in- structions. The samples tested for proviral DNA using two different PCR protocols. FeLV pol gene region-specific primer sets (Forward primer:
5’CYAMCCRTTATTRGGDAGAGA3′ and Reverse primer:
5’CCAGCAAGAGGTCATCTACA3′) [26] and FIV gag gene
region-specific primer sets (1026F: 5’GGCATATCCTATTCAAACAG3′ and 1700R: 5’AAGAGTTGCATTTTATATCC3′) [36] were used to
amplify 791 bp and 558 bp segments, respectively. The PCR reaction miXture prepared in a 20 μl final volume consisted to 2X miX buffer (So Fast EvaGreen SupermiX, Bio-Rad), 400 nM each of forward and reverse primer and DNA template. The positive DNAs from previously clinical
Fig. 1. This map shows the study sampling area. (A, B). There are 13 different districts (A) (Balçova, Bayraklı, Bornova, Buca, Çig˘li, Gaziemir, Güzelbahce, Kar- abag˘lar, Kars¸iyaka, Konak, Narlıdere, Seferihisar, Torbalı) distributed among the Izmir, in West of the Turkey (B). The sampled districts are red marked.

studies positive by PCR and confirmed by sequence analysis were used as positive control for both viruses. Sterile distilled water was used as the negative control. PCR conditions were carried out with an initial denaturation at 98 ◦C for 2 min, followed by 40 cycles of a denaturation step at 98 ◦C for 5 s, annealing step at 55 ◦C for FeLV and at 53 ◦C for FIV for 10 s, extension step at 65 ◦C for 10 s. The final extension was at 65 ◦C for 2 min. All PCR products were electrophoresed using 1.5–2 % agarose gel containing ethidium bromide and visualized under UV light. PCR positive amplicons were selected for purification and sequence analysis
to each distinct and represented for sampling districts for both viruses. The distinct five samples were selected for each sampling area for both viruses. A commercial PCR clean-up kit (GenJet PCR Purification Kit, Thermo) was used to purify FeLV PCR products, and a gel extraction kit (GenJet Gel EXtraction Kit, Thermo) used to purify FIV PCR positive product. All the purification steps were performed according to the manufacturer’s instructions.
2.3.2. Sequence analysis and phylogeny
The purified amplicons were sequenced in both directions using the Sanger method. A Beckman Coulter Genetic Sequencer was used for this purpose (GenomeLab GeXP Genetic Analysis System). The obtained nucleotide sequences were evaluated for similarity using the NCBI BLAST (Basic Local Alignment Search Tool, http://www.ncbi.nlm.nih. gov). Chromas (version 2.6.1) and BioEdit (version 7.2.5) programs used to edit and compare the sequences. The evolutionary and phylo- genetic analysis conducted using the Clustal W algorithm exerts in the MEGA software program (version 10.0). Two methods were used for phylogenetic tree construction. The phylogenetic tree constructed by the neighbour joining method used Kimura’s two-parameter bootstrap value with 1000 replicate. The Maximum Likelihood method performed Kimura’s two-parameter model with bootstrap analysis 1000 replicates.

3. Results
A total of 1008 blood samples were used to investigate proviral DNA. A total of 977 serum samples were analyzed for FIV and FeLV antibodies and FeLV p27 antigen. Proviral DNA positivity was detected in 25.2 % (254/1008) for FIV and in 69.7 % (703/1008) for FeLV by PCR. The 22.3
% (n 225) of cats were positive for both viruses, in 80.36 % (n 810) positivity detected for least one virus (FIV and/or FeLV). FIV antibody positivity was in 25.5 % (249/977) and FeLV antibody was in 45.2 % (442/977). Of the tested cats, 302 (30 %) were positive for FIV-ELISA and/or FIV-PCR. The 57.6 % (n 174) were detected positive both FIV antibodies, the proviral DNA as well, in 24.8 % (n 75) were only positive to antibodies against FIV, and in 19.2 % (n 58) existed FIV- proviral DNA.
To estimate FeLV infection stages in sampled cats were consider the antigen, antibodies and proviral DNA existence. Thirty-two (3.3 %) were positive to SNAP test for FeLV p27 Ag and defined as viremic cats. All p27 antigen-positive samples were positive for proviral DNA and negative for FeLV antibodies. These cats seem to have a progressive infection possibility. SiXteen cats (1.6 %) among antibody-positive samples were positive only for FeLV-Ab, negative for viral antigen and proviral DNA. These cats probably aborted infected with FeLV and defined as abortive infection. The 43.6 % of FeLV positive samples were positive both for proviral DNA and FeLV antibodies. These cats were described as regressive infected.
The samples used were previously tested for Leishmania and Toxo- plasma [34,35]. When evaluating the co-positivity of FIV and FeLV’s proviral DNA, Toxoplasma gondii and Leishmania, 53.2 % of cats were positive at least two pathogens (Fig. 2). The positivity of single pathogen was found 46.8 %, whereas only eight cats were positive for four pathogens. The rate of Toxoplasma gondii co-existence with FIV and/or

Fig. 2. (A). The proportion of single and multiple pathogens for the investigated four pathogens patterns. (B). The ratio of single and multiple pathogens according to each being together. The prevalence/seroprevalence positivity rate for Leishmania and T. gondii was indicated according to previous reports [34,35].

FeLV was 36.3 %, whereas this rate for Leishmania with FIV and/or FeLV was as lower as 12.2 %. Moreover, both T.gondii and FeLV’s co-existence rate was the highest among multiple pathogen positive cats.
The prevalence proportion for two viral infections was estimated using the serological and molecular assays. Therefore, the sequence analysis method was performed for the molecular definition of proviral DNA structures in this study. A total of seventeen pol gene sequences (TR5/268, TR5/DM5, TR7/289, TR8/559, TR9/518, TR10/247, TR11/ 677, TR11/561, TR12/678, TR13/547, TR14/976, TR15/974, TR16/
966, TR17/969, TR18/793, TR19/777, TR49) for FeLV positive samples and seven gag gene sequences (TR38, TRB97/15, TRB750/8, TR242/10, TRB568/48, TRB58/41, TR329/37) for FIV were analyzed BLAST web service and aligned using Bioedit program with other reference se- quences retrieved in GenBank under accession numbers (MH040766- MH040780, MW601026, MW601027, MW620965, MZ361585- MZ361590).
The phylogenetic tree based on the partial gag gene (p24) region was constructed using subtypes A, B, C, D, E, F related to FIV referred from various countries. TRB58/41, TRB329/37 sequences clustered within subtype A clade, TR38, TRB97/15, TRB568/48 sequences within subtye- B clade and TRB750/8, TR242/10 sequences within subtype-C clade among previously referenced GenBank FIV sequences in the phyloge- netic tree (Fig. 3). The obtained seven FIV sequences shared with 82–100 % similarity among themselves, whereas had 82–97 % similarity

with other announced sequences from Turkey [37]. TR38, TRB97/15 and TRB568/48 FIV sequences was closer to Turkey’s previously defined counterparts with 91–97 % rate. The obtained FIV sequences had simi- larity of 78–93 % with other GenBank FIV reference subtype A, B, C sequences.
The phylogenetic tree was constructed for FeLV using exFeLVs, enFeLVs and β-ERV sequences data of previously reported subgroups. Fifteen sequences observed as enFeLV, and two sequences were as exFeLV (Fig. 4). The enFeLV sequences were highly conserved with each other and clustered within two main subgroups (Figs. 4 and 5). Ac- cording to the pairwise identity rate and phylogenetic tree, the obtained enFeLVs grouped in this study (Figs. 4, 5) and exFeLVs were a more distant and separate group, showed different percentage rate and branches (Fig. 4). Their similarity rate varied to 96.9–99.5 % among enFeLV sequences, as well, a 95.5 % similarity rate was between two exFeLV sequences. The obtained enFeLV and exFeLV shared a 91.9–94.8
% similarity rate. There reached no sequences related to the pol gene
previously reported from Turkey so that the comparison was made only with GenBank sequences registered from other countries. This is the first report submitted to the pol gene of domestic FeLV isolates from Turkey. The obtained exFeLV sequences closer clustered to subtype A FeLV with 91.5–95.2 % similarity and branched with other FeLV-A counterparts in the phylogenetic tree. EnFeLV were clustered into the enFeLV group, which including sequences mostly related to clinical FeLV disease.

Fig. 3. The phylogenetic tree of FIV partial gag (p24) sequences was constructed using Mega software (version X) using the Maximum Like- lihood method, Kimura 2-parameter model and bootstrap analysis 1000 replicates. The current sequence was marked with a dot. The con- cerned FIV sequence was compared with different FIV subtype sequences from GenBank (Subtype A: GU055218, M36968, M25381, D37820, GQ339818, L06311; Subtype B: MH325071, MH325068, MH325056, MH325055,AF531057, EU130945, AF361320, AY139110, D37821, DQ407170, DQ407187, Y13866, Y13867, Subtype C: AF474246, AY600517; Subtype D: D37822, AY67985; Subtype E: AB027302, AB027304, EF413007, EF413009; EF413011, EF4130014, Subtype F: GQ406242).
Fig. 4. (A).The phylogenetic tree of the obtained FeLV sequences in this study was built using the neighbour joining method kimura’s two-parameter and bootstrap value with 1000 replicates (B). Two-dimensional colour graphical representation of pairwise identity for the partial pol gene of FeLV. A scale with the percentage colour code is presented.
We analyzed the deduced amino acid sequences of FeLVs pol regions. They highly conserved each other (data not showed). The conservation of reverse transcriptase (RT) motif has previously reported among beta and gamma retroviruses belonging to different species [38]. Accord- ingly, both “LPQGFKN” and “YVDD” motifs were mostly conserved in the obtained FeLV sequences in this study (Fig. 6) and showed higher similarities to other enFeLVs and exFeLV. In a few sequences, there was a slight variation in L****** and YV*D motifs. These changes did not affect classification in the phylogenetic tree of amino acid sequences (data not shown).
4. Discussion
The FIV and FeLV infections are seriously issued in the feline pop- ulations and threaten feline health by reducing immunomodulation, may resulting in malignancy. Due to the horizontal and vertical trans- mission of these viruses into the cat population, their global incidences may increase dramatically in the future [1–3]. Therefore more infor- mation is needed about these viruses and infections, essential for pro- tecting cat health, and AAFP recommends also acquiring updated knowledge of Feline retrovirus infections [20]. Previous studies demonstrated the prevalence of FeLV and FIV infections differs ac- cording to various features such as sex, age, lifestyle, outdoor/indoor, multiple-cat environments, healthy/sick, etc [23,25,39]. The common considerations about high infection rates depend on the individual im- munity, the hygienic status of outdoor or stray cats and multiple cat environment status [23,25,27]. This study investigated FIV and FeLV infection prevalence among the stray cat population in Western Turkey. High FIV and FeLV prevalence was detected in the sampled cats living outdoor which have not enough hygiene [26,40].
The previous FIV prevalence records indicated in Turkey was 3 % to
22.3 % [28,29,32,33]. Currently reported, two molecular-based FIV

studies referred to 9.5–10 % proviral DNA positivity [32,37]. The highest seropositivity reported from Istanbul was 22.3 % [28] then from Western Turkey was 19.2 % [33]. The FIV seropositivity and FIV pro- viral DNA positivity detected in the current study was higher than pre- vious reports published in Turkey. FIV prevalence varies according to the country, such as 6.1 % in Italy [27], 20.9 % in Spain [24], 3.6 % in Germany [23], 10.4 % in England [41], 33.3 % in Slovenia [40], 18.9 %
in Cyprus [39], 9.12 % in China [25], 23.2 % in Japan [42] and 21–25 % in Australia [43]. Our results are higher than most of them.
The FeLV prevalence reported 35.7 % in Spain [21], 47.5 % in Brasil [22], 76 % in Mexico [26], whereas 4.5–20.5 % in Turkey [28,30,32, 33]. Previously reported FeLV Ag positivity ranged 3.8 % to 7.6 % and Ab positivity 7.5–58.1 % [30,33]. The proviral DNA positivity recorded
20.5 % [32], whereas current results indicated 3.3 %, 45.2 %, 69.7 % for Ag, Ab and proviral DNA positivity, respectively. FeLV infection prev- alence may monitor with different diagnostic tests as antigen (p27-Ag) detection, antibodies detection and proviral DNA existence. Even though the viral p27 antigen tests are useful for screening active viremia, it is applied easily in veterinary. Still, it may be inadequate to catch cats all exposed [2], so monitoring antibodies and proviral DNA was preferred [12]. The FeLV positive cats were 3.3 % viremic, whereas regressive infected was 43.6 %.
FeLV infections may cause different scenarios after viral exposure. The antibody response may develop in vaccinated, regressive or recov- ered cats, but antibody occurrence may not enough to prevent proviral DNA integration [2]. These cats may be protected from active viremia but remain infected with provirus, also have viral recombination risk and neoplasia possibility [13,44]. The healthy looks cats are if regressive infected, they may have reactivation risk following immunosuppressive situations. The antiviral immunity balance, stress factors, and co-infections may issue as cats’ prognostic factors. These cats’ periodic viral monitoring may be implicated in managing FeLV associated
Fig. 5. The phylogenetic tree for partial pol gene of FeLV sequences. The tree was constructed using Mega software (version X) with neighbour joining method Kimura’s two-parameter and bootstrap value with 1000 replicates. The generated sequences in this study were marked with dot and circular. The concerned FeLV sequences was compared with different gamma and beta retrovirus sequences from GenBank (ERV: M18246, Y12713; enFeLV: M18246, Y12713, JF939190- JF939199, AB674444, EU030001, AY364318, AY364319, JF939197, JF939198, L06140, KR030135-KR030141, LC196055; exFeLV: M18247, AF052723, JF957363, AB674444, AB672612, AB060732, MT129531, JF957361, JF957363, KP728112).

diseases [13]. Progressive infection is likely in the seronegative cats with antigen and proviral DNA positivity. This progressive status in FeLV infection can uptake the virus in the bone marrow which may causes clinical disease progression throughout the cat’s life. Since the prognosis of these cats is acceptable as unfavorable in clinical and epidemiological terms, it is recommended to follow them up. They have a high potential to mediate transmission of the virus to other susceptible cats, so the presence of these cats poses a risk for other cats.
The cats may frequently be exposed to mutual grooming and fighting behaviour in multiple-cat environment and shelters [20]. FeLV posi- tivity risk has been increased in cats living in shelters and free-roaming cats [20,22,26]. Gingivitis and mucosal injuries may increase predis- posing to FIV/FeLV infections [45]. Individual viral transmissions get much easier under these conditions [20]. More detailed studies may reveal the influence of stray cats in natural infection circulations.
FIV/FeLV coinfections have been previously evaluated as a risk factor due to a predisposition to Leishmania and T. gondii infections, especially in endemic areas [3,24,27]. Previous studies demonstrated the relation of FeLV/FIV co-infections with ToXoplasmosis /Leishmani- asis positivity [3,27,39,46,47]. The current study indicated that

co-infection positivity higher than the earlier results. Previous studies reported high T. gondii/FIV co-infection percentages, whilst the much higher T. gondii / FeLV co-positivity rates indicated in the current study (Fig. 2). FIV / Leishmaniasis positivity frequently reported in several searches [3,46,47], whereas in the present study, FeLV/Leishmaniasis positivity detected more frequent.
Concurrent infections are significant in shelter cats’ disease prog- nosis; individual immune deficiency or unresponsiveness may evolving to population-level defence failures. This is indicated increased health risk and the situation especially more critical in unqualified animal shelters. The exposure probability of shelter cats to various pathogens may pose a risk for sustainable cat health management [13,20,48]. Therefore it is suggested to periodically screen feline retroviruses and coinfections such as ToXoplasmosis/Leishmaniasis to prevent zoonotic diseases based “One Health” concept.
In this study, we attempted to identify FeLV in cat genome, classify the subgroups and characterize the genetic variations. The pol gene region sequence-data has been focused especially on RT regions for subgroups, with compared previously reported enFeLVs and exFeLV. Our analysis detected high homology between the FeLVs sequences
Fig. 6. Multiple alignment sequences of FeLV partial pol sequences. The figure showed that the RT region (composed of 73 amino acids) highly conserved region among the obtained FeLV and other retroviruses. The concerned FeLV compared with gamma and beta retroviruses belonging to different species (Canine: HM460338; Simian: U85505; Murine: AF033811, Mice: Y12713, M15122; Feline: M18247, AF052723, JF957363, AB674444, AB672612, AY364318, AY364319,
JF939197, JF939198, KR030138, KR030140). The boXes indicate the RT motif sequences.
clustered into two main groups based on phylogenetic properties into enFeLV and exFeLV. Current EXFeLV sequences overlapped to subtype-A cluster. Current sequences’ genome-level diversity showed similarity with other enFeLVs 96 % and 99 %. The reference exFeLV (FeLV-A) sequences were closer to the current enFeLV sequences, with 88–90 % similarity. The pol and pro-pol gene regions of ERVs investigated in a few studies, and although limited information about circulating viruses, demonstrated the generally conserved motifs [26,38]. High-level ho- mology in protease and RT motifs has been recorded within the pol gene of enFeLVs, whereas variation and recombination have been observed in various species [38].
Comparing the structural differences of RT motifs (LPQGFKN and YVDD sequences) among FeLVs and gamma retroviruses indicated generally conserved in our results. The phylogenetic trees showed that the present enFeLVs sequences were shared the same groups with enFeLVs, such as enFeLV-GGAG, enFeLV-AGTT, en-FeLV CFE-6 isolates. The enFeLV-GGAG, enFeLV-AGTT and enFeLV CFE-6 sequences have been previously discovered mediated cats’ clinical disorder [7]. Other enFeLV groups consisted of the integrated infectious ERV sequences into the cat genome, such as DC-10 and RD-114 implicated as replicative competent [49].
EnFeLVs have importance on FeLV infections. The recombination possibility between exFeLV-A genotype with others may lead to emerging new variants, clinical disorders, and increased circulation of feline populations’ disease [22]. The enFeLV genome has been accepted as a variation source for emerging exFeLV subgroups in several reports [7,10,50,51]. A previous study reported FeLV-B formation by analyzing the recombination between the enFeLV/env-LTR and FeLV-A sequences [7,50]. A previously explained hypothesis revealed a relation between enFeLV and the development of the clinical disease.
To date, seven FIV subtypes have been defined worldwide by molecular-based studies using viral env and gag genes data [16,17]. The previous studies reported FIV subtype B from Turkey [31,37]. According to the analysis of FIV gag gene sequences in this study, three subtypes were identified, and type A and type C was reported for the first time.

The current subtype B sequences were found closer (91–97 % similarity) to the sequences previously identified from Turkey. They classified it in a separate cluster from other subtype B sequences reported from Europe, America, and Asia in the phylogenetic tree (Fig. 3). The current subtype A and subtype C sequences were clustered in their counterparts as the GenBank sequences reported from Europe, America, and Asia. Further research and data would detect the most prevalent subtypes circulating in Turkey. Thus, exhibition of the virus variability and all variants effective in natural infections as well as additionally epidemiological data, would ensure a more effective diagnosis and control of the disease. If prophylactic measures may not perfectly be implemented in stray cats, more potential risk may occur for such viral diseases. Once ac- quired, FIV infection is lifelong, and there is no known recovery or cure [20,52]. FIV infects CD T cells resulting in CD4 /CD8 reduction, immunosuppression and immunodeficiency. Immune dysfunction, chronic and recurrent infections mediated neoplasia is remarkable in infected cats [15,20,52]. The excellent risk management applications and common vaccination may reduce cats’ prevalence if shelter prac-
tices and animal welfare rules should consider.
5. Conclusions
Overall, we investigated the FIV / FeLV infections among looking healthy stray cats from Western Turkey using serologic, antigenic, and molecular-based tests. The prevalence rates for both diseases were found moderately high. The molecular characterization of pol genes of enFeLV and exFeLV samples and gag gene of FIV samples was performed suc- cessfully. The findings revealed that FeLV subtype A and FIV subtype A, subtype B, and, subtype C circulate among Turkish stray cats. Single and multiple co-infection positivity was found higher compared to previous reports. Periodic monitoring of pathogens is a humane way of respecting and protecting the cat population’s health and right to life, given the carrier stray cats’ possible contact with the owned cats.

Funding
The authors received no financial supports for authorship, and/or publication of this article.
CRediT authorship contribution statement
Dilek Muz: Conceptualization, Data curation, Investigation, Meth- odology, Project administration, Supervision, Writing – review & edit- ing. Hüseyin Can: Conceptualization, Data curation, Investigation, Methodology, Supervision, Writing – review & editing. Muhammet Karakavuk: Conceptualization, Data curation, Investigation, Method- ology, Supervision, Writing – review & editing. Mert Do¨s¸kaya: Conceptualization, Data curation, Investigation, Methodology, Super-
vision, Writing – review & editing. Hüseyin Go¨khan O¨ zdemir: Inves-
tigation, Methodology. Aysu Deg˘irmenci Do¨s¸kaya: Conceptualization, Data curation, Investigation, Methodology, Supervision, Writing – re- view & editing. Esra Atalay S¸ ahar: Investigation, Methodology. Bayram Pektas¸: Investigation, Methodology. Mehmet Karakus¸: Investigation, Methodology. Seray To¨z: Investigation, Methodology.
Yusuf O¨ zbel: Investigation, Methodology. Adnan Yüksel Gürüz: Data
curation, Investigation, Methodology. Mustafa Necati Muz: Concep- tualization, Data curation, Investigation, Methodology, Supervision, Writing – review & editing.
Declaration of Competing Interest
The authors report no declarations of interest.
References
[1] Y. Fujino, K. Ohno, H. Tsujimoto, Molecular pathogenesis of feline leukemia virus- induced malignancies: insertional mutagenesis, Vet. Immunol. Immunopathol. 123 (1–2) (2008) 138–143.
[2] K. Hartmann, Clinical aspects of feline retroviruses: a review, Viruses (4) (2012) 2684–2710.
[3] L.S. Sobrinho, C.N. Rossi, J.P. Vides, E.T. Braga, A.A. Gomes, V.V. de Lima, S.
H. Perri, D. Generoso, H. Langoni, C. Leutenegger, A.W. Biondo, M.D. Laurenti,
M. Marcondes, Coinfection of Leishmania chagasi with ToXoplasma gondii, Feline Immunodeficiency Virus (FIV) and Feline Leukemia Virus (FeLV) in cats from an endemic area of zoonotic visceral leishmaniasis, Vet. Parasitol. 8 (1–2) (2012) 302–306, 187.
[4] W.D. Hardy, P.W. Jr Hess, E.G. MacEwen, A.J. McClelland, E.E. Zuckerman,
M. Essex, S.M. Cotter, O. Jarrett, Biology of feline leukemia virus in the natural environment, Cancer Res. 36 (2) (1976) 582–588.
[5] W.D. Hardy, L.J. Jr Old, P.W. Hess, E.G. MacEwen, A.J. McClelland, E.
E. Zuckerman, M. Essex, S.M. Cotter, O. Jarrett, Horizontal transmission of feline

[15] N. Pedersen, E. Ho, M. Brown, Isolation of a T-lymphotropic Virus from Domestic cats with an immunodeficiency-like syndrome, Science (235) (1987) 790–793.
[16] R.K. Kann, M.T. Kyaw-Tanner, J.M. Seddon, P.R. Lehrbach, R.J. Zwijnenberg,
J. Meers, Molecular subtyping of feline immunodeficiency virus from domestic cats in Australia, Aust. Vet. J. 84 (4) (2006) 112–116.
[17] B.M. TeiXeira, S.A. Taniwaki, P.M.M. Menezes, A.K.P.P. Rodrigues, A.N. Mouta, T.
L.M. Arcebispo, G.F. Braz, J.C.M. da Cruz, P.E. Branda˜o, M.B. Heinemann, M.
X. Silva, M.J. Hosie, Feline immunodeficiency virus in Northern Cear´a, Brazil, J. Feline Med. Surg. 8-5 (2) (2019), 2055116919859112.
[18] P.C. Crawford, J.K. Levy, New challenges for the diagnosis of immunodeficiency feline virus infection, Vet. Clin.N. Am. Small Anim. Pract. (37) (2007) 335–350.
[19] M.E. Westman, R. Malik, E. Hall, P.A. Sheehy, J.M. Norris, Determining the Feline Immunodeficiency Virus (FIV) status of FIV-vaccinated cats using point-of-care antibody kits, Comp. Immunol. Microbiol. Infect. Dis. (42) (2015) 43–52.
[20] S. Little, J. Levy, K. Hartmann, R. Hofmann-Lehmann, M. Hosie, G. Olah, K.
S. Denis, AAFP feline retrovirus testing and management guidelines, J. Feline Med. Surg. 22 (1) (2020) 5–30.
[21] A. Arjona, E. Gomez-Lucia, Evaluation of a novel nested PCR for the routine diagnosis of feline leukemia virus and feline immunodeficiency virus, J. Feline Med. Surg. Open Rep. 9 (1) (2007) 14–22.
[22] F.M. Coelho, M.R. Bomfim, F. de Andrade Caxito, N.A. Ribeiro, M.M. Luppi, E.
A. Costa, M.E. Oliveira, F.G. Da Fonseca, M. Resende, Naturally occurring feline leukemia virus subgroup A and B infections in urban domestic cats, J. Gen. Virol. 89 (11) (2008) 2799–2805.
[23] S.E. Gleich, S. Krieger, K. Hartmann, Prevalence of feline immunodeficiency virus and feline leukaemia virus among client-owned cats and risk factors for infection in Germany, J. Feline Med. Surg. Open Rep. 11 (12) (2009) 985–992.
[24] K. Sherry, G. Miro, M. Trotta, C. Miranda, A. Montoya, C. Espinosa, F. Ribas,
T. Furlanello, L.A. Solano-Gallego, A serological and molecular study of Leishmania infantum infection in cats from the Island of Ibiza (Spain), Vector Borne Zoonotic Dis. 11 (3) (2011) 239–245.
[25] W. Cong, Q.F. Meng, R. Blaga, I. Villena, X.Q. Zhu, A.D. Qian, ToXoplasma gondii, Dirofilaria immitis, Feline Immunodeficiency Virus (FIV), and Feline Leukemia Virus (FeLV) infections in stray and pet cats (Felis catus) in northwest China: coinfections and risk factors, Parasitol. Res. 115 (1) (2016) 217–223.
[26] H. Ramírez, M. Autran, M.M. Garci, M.A. Carmona, C. Rodriguez, H.A. Martinez, Genotyping of feline leukemia virus in Mexican housecats, Arch. Virol. 161 (4) (2016) 1039–1045.
[27] E. Spada, I. Canzi, L. Baggiani, R. Perego, F. Vitale, A. Migliazzo, D. Proverbio, Prevalence of Leishmania infantum and coinfections in stray cats in northern Italy, Comp. Immunol. Microbiol. Infect. Dis. (45) (2016) 53–58.
[28] H. Yılmaz, A. Ilgaz, D.A. Harbour, Prevalence of FIV and FeLV infections in cats in Istanbul, J. Feline Med. Surg. Open Rep. (2) (2000) 69–70.
[29] N. Yuksek, A. Kaya, N. Altug, C. O¨ zkan, Z.T. Agaoglu, Prevalence of feline
retrovirus infections in van cats, Bull. Vet. Inst. Pulawy (49) (2005) 375–377.
[30] T.C. Oguzoglu, K. Can-Sahna, V.S. Ataseven, D. Muz, Prevalence of feline coronavirus (FCoV) and feline leukemia virus (FeLV) in Turkish cats, Ankara Univ. Vet. Fak. Derg. (57) (2010) 271–274.
[31] T.C. Oguzoglu, M.O. Timurkan, D. Muz, A. Kudu, First molecular characterization of feline immunodeficiency virus in Turkey, Arch. Virol. (155) (2010) 1877–1881.
[32] T.C. Oguzoglu, D. Muz, M.O. Timurkan, N. Maral, I. Gurcan, Prevalences of Feline Coronavirus (FCoV), Feline Leukaemia Virus (FeLV), Feline Immunodeficiency Virus (FIV) and Feline Parvovirus (FPV) among domestic cats in Ankara, Turkey, Rev Med Vet. (164) (2013) 511–516.
[33] N. Erol, S. Pasa, An investigation of the Feline Immunodeficiency Virus (FIV) and feline leukemia virus (FeLV) infections in cats in Western Turkey, Acta Sci. Vet.

leukaemia virus, Nature (244) (1973) 266–269.

(41) (2013) 1166.
¨ ˙

[6] S. Polani, A.L. Roca, B.B. Rosensteel, S.O. Kolokotronis, G.K. Bar-Gal, Evolutionary dynamics of endogenous feline leukemia virus proliferation among species of the domestic cat lineage, Virology 405 (2) (2010) 397–407.
[7] R. Pandey, A.K. Ghosh, D.V. Kumar, B.A. Bachman, D. Shibata, P. Roy-Burman, Recombination between feline leukemia virus subgroup B or C and endogenous env elements alters the in vitro biological activities of the viruses, J. Virol. 65 (12) (1991) 6495–6508.
[8] R. Tandon, V. Cattori, A.C. Pepin, B. Riond, M.L. Meli, M. McDonald, M.G. Doherr,
H. Lutz, R. Hofmann-Lehmann, Association between endogenous feline leukemia virus loads and exogenous feline leukemia virus infection in domestic cats, Virus Res. (135) (2008) 136–143.
[9] O. Jarrett, W.D. Hardy, M.C. Golder, D. Hay, The frequency of occurrence of feline leukaemia virus subgroups in cats, Int. J. Cancer (21) (1978) 334–337.
[10] E.S. Chiu, E.A. Hoover, S.A. VandeWoude, Retrospective examination of feline leukemia subgroup characterization: viral interference assays to deep sequencing, Viruses (10) (2018) 29.
[11] M.J. Beall, J. Buch, R.J. Cahill, G. Clark, J. Hanscom, M. Estrada, C.
M. Leutenegger, R. Chandrashekar, Evaluation of a quantitative enzyme-linked immunosorbent assay for feline leukemia virus p27 antigen and comparison to proviral DNA loads by real-time polymerase chain reaction, Comp Immunol MicrobiolInfect Dis. (67) (2019), 101348.
[12] M.E. Westman, R. Malik, J.M. Norris, Diagnosing feline immunodeficiency virus (FIV) and feline leukaemia virus (FeLV) infection: an update for clinicians, Aust. Vet. J. 97 (3) (2019) 47–55.
[13] R. Hofmann-Lehmann, K. Hartmann, Feline leukaemia virus infection: a practical approach to diagnosis, J. Feline Med. Surg. (22) (2020) 831–846.
[14] R. Hofmann-Lehmann, J.B. Huder, S. Gruber, F. Boretti, B. Sigrist, H. Lutz, Feline leukaemia provirus load during the course of experimental infection and in naturally infected cats, J. Gen. Virol. (82) (2001) 1589–1596.
[34]
H. Can, M. Do¨s¸ kaya, D. Ajzenberg, Ozdemir, A. Caner, S.G. Iz, A.D. Do¨s¸kaya,
E. Atalay, Ç. Çetinkaya, S. Ürgen, S. Karaçalı, C. Ün, M.L. Dard´e, Y. Gürüz, Genetic characterization of ToXoplasma gondii isolates and toXoplasmosis seroprevalence in stray cats of I˙zmir, Turkey, PLoS One 9 (8) (2014) e104930.
[35] H. Can, M. Do¨s¸ kaya, H.G. O¨ zdemir, E.A. S¸ ahar, M. Karakavuk, B. Pektas¸ ,
M. Karakus¸ , S. To¨z, A. Caner, A.D. Do¨s¸kaya, S.G. I˙z, Y. O¨ zbel, Y. Gürüz, Seroprevalence of Leishmania infection and molecular detection of Leishmania tropica and Leishmania infantum in stray cats of I˙zmir, Turkey, EXp. Parasitol.
(167) (2016) 109–114.
[36] G. Cammarota, L. Da Prato, E. Nicoletti, D. Matteucci, M. Bendinelli, M. Pistello, Quantitation of feline immunodeficiency proviruses in doubly infected cats using competitive PCR and a fluorescence-based RFLP, J. Virol. Methods 62 (1) (1996) 21–31.
[37] B.Y. Koc, T.C. Oguzoglu, A phylogenetic study of Feline Immunodeficiency Virus (FIV) among domestic cats in Turkey, Comp. Immunol. Microbiol. Infect. Dis. (73) (2020), 101544.
[38] H. Jo, H. Choi, M.K. Choi, N. Song, J.H. Kim, J.W. Oh, K. Seo, H.G. Seo, T. Chun, T.
H. Kim, C. Park, Identification and classification of endogenous retroviruses in the canine genome using degenerative PCR and in-silico data analysis, Virology (422) (2012) 195–204.
[39] C. Attipa, K. Papasouliotis, L. Solano-Gallego, G. Baneth, Y. Nachum-Biala,
E. Sarvani, T.G. Knowles, S. Mengi, D. Morris, C. Helps, S. Tasker, Prevalence study and risk factor analysis of selected bacterial, protozoal and viral, including vector- borne, pathogens in cats from Cyprus, Parasit. Vectors 10 (130) (2017).
[40] T. Natasa, N. Svete, M. Zemljic, M. Zakosek, B.M. Darja, High prevalence Of Feline Immunodefiency Virus (FIV) and Feline Leukemia Virus (FeLV) in Slovenia, Acta Veterinaria (Beograd) 58 (2–3) (2008) 191–201.

[41] A. Muirden, Prevalence of feline leukemia virus and antibodies to feline immunodeficiency virus and feline corona virus in stray cats sent to an RSPCA hospital, Vet. Rec. (150) (2002) 621–625.
[42] Y. Nakamura, Y. Nakamura, A. Ura, M. Hirata, M. Sakuma, Y. Sakata, K. Nishigaki,
H. Tsujimoto, A. Setoguchi, Y. Endo, An updated nation-wide epidemiological survey of Feline Immunodeficiency Virus (FIV) infection in Japan, J. Vet. Med. Sci. 72 (8) (2010) 1051–1056.
[43] J.M. Norris, E.T. Bell, L. Hales, Prevalence of feline immunodeficiency virus infection in domesticated and feral cats in eastern Australia, J. Feline Med. Surg. 9 (4) (2007) 300–308.
[44] A.N. Torres, C.K. Mathiason, E.A. Hoover, Re-examination of feline leukemia virus: host relationships using real-time PCR, Virology (332) (2005) 272–283.
[45] M.R. Kornya, S.E. Little, M.A. Scherk, W.C. Sears, D. Bienzle, Association between oral health status and retrovirus test results in cats, J. Am. Vet. Med. Assoc. (245) (2014) 916–922.
[46] W. Sukhumavasi, M.L. Bellosa, A. Lucio-Forster, J.L. Liotta, A.C. Lee,
P. Pornmingmas, S. Chungpivat, H.O. Mohammed, L. Lorentzen, J.P. Dubey, D.
D. Bowman, Serological survey of ToXoplasma gondii, Dirofilaria immitis, Feline Immunodeficiency Virus (FIV) and Feline Leukemia Virus (FeLV) infections in pet cats in Bangkok and vicinities, Thailand, Vet. Parasitol. 188 (1–2) (2012) 25–30.

[47] B. Akhtardanesh, N. Ziaali, H. Sharifi, S. Rezaei, Feline immunodeficiency virus, feline leukemia virus and ToXoplasma gondii in stray and household cats in Kerman-Iran: seroprevalence and correlation with clinical and laboratory findings, Res. Vet. Sci. 9 (2) (2010) 306–310.
[48] S. Ravicini, J. Pastor, J. Hawley, Prevalence of selected infectious disease agents in stray cats in Catalonia, Spain, J. Feline Med. Surg. Open Rep. 29-2 (1) (2016), 2055116916634109.
[49] R.H. Reeves, S.J. O’Brien, Molecular genetic characterization of the RD-114 gene family of endogenous feline retroviral sequences, J. Virol. 52 (1) (1984) 164–171.
[50] M.A. Stewart, M. Warnock, A. Wheeler, N. Wilkie, J.I. Mullins, D.E. Onions, J.
C. Neil, Nucleotide sequences of a feline leukemia virus subgroup A envelope gene and long terminal repeat and evidence for the recombinational origin of subgroup B viruses, J. Virol. (58) (1986) 825–834.
[51] J. Borjatsch, B.S. Kristal, G.A. Viglianti, R. Khiroya, E.A. Hoover, Mullins Feline leukemia virus subgroup C phenotype evolves through distinct alterations near the N-terminus of the envelope surface glycoprotein, Proc. Natl. CompK Acad. Sci. U.S.A. (89) (1992) 8457–8461.
[52] F. Courchamp, D. Pontier, M. Langlais, M. Artois, Population dynamics of feline immunodeficiency virus within cat populations, J. Theor. Biol. 21 (4) (1995) 553–560, 175.