Overnight cultures were subcultured into Dulbecco’s modified Eagle medium (DMEM) at the dilutions indicated. DMEM in this report refers to DMEM-F12 (Sigma-Aldrich) containing L-glutamine and 4500 mg/L glucose, supplemented with 18 mM NaHCO3 and 25 mM HEPES, pH 7.4. DMEM-F12 from Sigma-Aldrich was previously determined to contain no more than 1.5 μM zinc [15]. The heavy metal content of the HEPES used in all culture media was measured AR-13324 datasheet by the

manufacturer (Promega) as less than 5 ppm. Therefore the media used in this study contain a negligible amount of zinc compared to the amounts added as a zinc acetate supplement (100 μM or more). Electrophoretic Mobility Shift Assay (EMSA) The LEE4 regulatory fragment (bases -468 to +460 relative to the transription start point) was amplified with primers K1150 and K1153 (Table 2) by PCR using plasmid pJLM165 as template [14]. DNA fragments were separated by 1.0% agarose gel electrophoresis, stained with ethidium bromide, excised and purified using a QIAQuick Gel Extraction kit (Qiagen). Ler protein was expressed from a pBadMycHis JIB04 vector and purified as described previously [17]. EMSA-based competition to assess Ler binding to LEE4 regulatory DNA was performed by using non-denaturing 5% polyacrylamide gels. Polyacrylamide gels were prepared

with a 37.5 : 1 acrylamide/bisacrylamide solution (Bio-Rad) following a standard protocol. Binding reaction mixtures containing 100 ng DNA, EMSA selleck chemical buffer (10 mM Tris, pH 7.4, 5 mM NaCl, 50 mM KCl, 50 mg/ml BSA), 0.5 μM Ler, and zinc acetate at the indicated concentrations were incubated at room temperature for 15 min. After the addition of glycerol to a concentration of 2.5% (v/v), samples were separated by electrophoresis at 4°C overnight at 35 V. Gels were stained

with ethidium bromide and imaged using a Bio-Rad Fluor-S MultiImager. Band intensities were quantified with the Gnu Image Manipulation Program (http://​www.​gimp.​org/​). Table 2 Oligonucleotide primers used in this study Primer Sequence 5’ – 3’ Strand Target Reference K1153 CCGGAATTCTGCCGATGGCACCAGACA + LEE4 [14] K1150 CGCGGATCCTGCCAAACATCGCCAAAGTAG − LEE4 [14]  β -galactosidase assays Plasmid pJLM164 containing a LEE1 lacZ fusion, and plasmid pJLM165 Tau-protein kinase containing a LEE4 lacZfusion were transformed into EPEC strains E2348/69 and LRT9, and into the plasmid-cured EPEC derivative JPN15 and the K-12 strain MC4100. Strains were cultured overnight in LB medium with 50 μg/ml kanamycin and then subcultured 1:100 into 3 ml DMEM buffered with 25 mM HEPES, pH 7.4, in the presence and absence of 0.3 – 0.5 mM zinc acetate. Cells were harvested with OD600 between 0.3 and 0.5, and β-galactosidase activity was monitored by standard methods [32]. Three independent assays were performed from each culture.