5 U/L selleck products (<40), alanine transaminase (ALT) 58.4 U/L (<41), gamma-glutamyltransferase (γGT) 81.9 U/L (11–50), and alkaline phosphatase (AP) 237 U/L (<270)]. Under the tentative diagnosis of an acute systemic allergic reaction, we initiated symptomatic treatment with oral prednisolone (1.5 mg/kg body weight OD) and inhaled budesonide/formoterol (200/6 µg BID). Under this treatment the respiratory symptoms improved, the laboratory parameters normalized, and it was possible

to taper down and finally discontinue oral prednisolone on August 29. Inhaled budesonide/formoterol was stopped on September 12 when the patient indicated complete resolution of all symptoms. A follow-up spirometry on October 11 was normal. of PZQ Since the advent of PZQ in the late 1970s, the drug has become the treatment of

choice against Sotrastaurin all species of Schistosoma.[2] As the drug is largely ineffective on young (7- to 28-d-old) stages of the parasite (schistosomula), delivery of treatment will only be effective upon maturation of the parasite and once the chronic stage of the infection has been reached.[3] In addition, the administration of PZQ during the acute phase may be associated (in 40–50% of cases) with paradoxical reactions (Jarish Herxheimer-like reactions) due to the drug’s partial effect on juvenile parasite stages.[3, 4] Hence it is generally advised to wait at least 3 months after exposure (marked by presence of eggs in stool or urine) before initiating PZQ treatment.[4, 5] On the other hand, delaying BCKDHA treatment increases the risk of severe ectopic manifestations (eg, neuroschistosomiasis). To reduce the immunological reactions, and to avoid or attenuate paradoxical reactions in patients with acute schistosomiasis (AS), co-administration of corticosteroids with PZQ is occasionally

considered. This approach, however, has the drawback that co-administration with corticosteroids decreases the plasma level of PZQ by approximately 50%.[6] Symptomatic AS (as a treatment-independent phenomenon during the early natural course of infection) and treatment-induced paradoxical reactions can manifest with identical symptoms: namely, fever, fatigue, and pulmonary symptoms (dry cough, shortness of breath, wheezing) as well as neurological signs.[3, 7, 8] Both are considered to constitute allergic reactions after exposure of a naive host to a high level of parasite antigens. These are evoked either by larval maturation and early oviposition in symptomatic AS or by parasite destruction in treatment-induced paradoxical reactions. In both cases eosinophil-mediated toxicity leading to vasculitis is considered to be the most likely pathophysiological correlate of the clinical manifestations (eg, pulmonary, cardiac, cerebral).[8, 9] The pulmonary symptoms in AS (S haematobium and S mansoni) have frequently been reported to persist for weeks (or even months) and may present without radiological findings.

We also found 11 unique alleles linked to virulence, and six linked to avirulent isolates (Table 3). The unique allele GA-SSR7 210 bp ABT-888 research buy was detected only within the highly pathogenic isolate T17G1 (27), to which 17 out of 19 differentials were susceptible. The 79 R. secalis isolates grouped into 64 distinct haplotypes by the seven loci, and distributed into two main clusters (Fig. 2). The distribution of these clusters by host showed that most isolates sampled from the

same host grouped together. Cluster I distributed the farthest from the second, and included five isolates (35, 76, 33, 32 and 75) that all originated from the Rihane host, but were genetically well differentiated. The second cluster was subdivided into 14 subgroups. The haplotypes (55, 44, 8, 2), (74, 49, 45, 23), (51, 7), (18, 16), (60, 19), (61, selleck chemicals 58, 43, 11) and (63, 29, 1) belonged to subgroups 1, 4, 5, 6, 11, 12 and 13, respectively, and were genetically similar. The unique 127 bp allele size of the TAC-SSR1 locus (Table 3) might have contributed to the genetic distinctiveness of pathotypes grouped in cluster I (Fig. 2). This allele was detected only within this set of isolates. The relationship between

variation in pathogenicity and microsatellite markers’ haplotype was assessed by comparing isolates with the same haplotype to their reaction spectra from the 19 differential cultivars (Table 4). A total of 25 isolates were compared, with two to four isolates having the same haplotype. The degree of coincidence ranged from 0.31 to 0.84, with a mean of 0.52. The highest coincidence of 0.84 was seen for the isolates T21H3 (61), T21E3 (58), clustered in subgroup 12 (Fig. 2), originating from the Zalfana population

(Table 1). Thus, microsatellite marker fingerprinting Florfenicol identified pathogenicity in 52% of the investigated isolates (Table 4). In this study, high pathogenicity and genetic variability at microsatellite loci was revealed for Tunisian R. secalis isolates collected from two different barley hosts: Rihane cv. and local barley landraces. This is consistent with the results from Bouajila et al. (2007), for molecular diversity in different agroecological zones by means of AFLP markers. We retraced patterns of pathogenicity within 79 Tunisian R. secalis isolates according to the reaction spectra of 19 differential cultivars (Fig. 1). This allowed classification into three virulence groups, with the isolate T10A1 (16) found to be the most virulent. Such a complex variation in pathogenicity creates a difficult environment for breeding resistance cultivars using major genes based on the gene-for-gene theory. We found that the resistance gene BRR2 carried by Astrix may be effective for breeding for resistance against scald, demonstrated by the low level of susceptibility of this cultivar (Table 2).

As shown in Fig. 3a and b, placing the ssi of pHW15 on the plus strand

could fully substitute the deleted ssi of pHW126 as indicated by the absence of multimers. In sharp contrast, placing the ssi on the opposite strand could not prevent accumulation of plasmid dimers and higher mers. This result confirms that a functional ssi site directing synthesis of the antisense strand is necessary to prevent multimer formation of pHW126 and denotes an ssi function to the accessory region. Recently, we have shown that deletion of the so-called accessory region of pHW126 causes plasmid instability (Rozhon et al., 2011). Here, we demonstrate that this can be addressed to rapid plasmid multimer formation. Although the number of pHW126-units per cell remains constant, multimerization decreases the number of physically independent plasmid molecules by about 40% presumably rendering random distribution to selleck daughter cells less effective. A conserved sequence within the accessory region was identified to be crucial for keeping pHW126 in its stable monomeric state. The predicted secondary structure resembled Afatinib nmr an ssi. With respect to that it is interesting to note that in pMV158 the ssoA (which has ssi function) has been reported to be physically

but not functionally linked to a segregational stability function (del Solar et al., 1993). However, Vitamin B12 the result that pHW126 derivatives lacking the palindromic region can be rescued by the ssi of pHW15, a plasmid unrelated to pHW126, clearly indicates that ssi activity rather than a potential physically linked function is crucial for keeping pHW126 in its monomeric form. Single-strand initiation sites function in an orientation-dependent manner (Gruss et al., 1987). Thus, it was expected that the ssi of pHW15 would rescue the multimerization

phenotype of pHW126 deletion versions only if inserted in an appropriate direction. Indeed, we found that functional substitution of the ssi of pHW126 was only possible by inserting the ssi of pHW15 into the plus strand and thus directing priming of the antisense strand, while placing the pHW15 ssi in the opposite direction had no effect. This result suggests also that the origin of replication placed in the minimal replicon directs synthesis of the sense strand. Thus, the structural organization of the pHW126 backbone displays a pattern typical for rolling circle plasmids: the rep gene encoding the replication protein is located downstream of the replication origin and a region providing ssi function is placed upstream of the origin. The sequence with ssi activity is often referred to as sso for singe-strand origin. However, rolling circle plasmids may contain more than one ssi signal, and thus, we hesitate to conclude that the ssi identified here represents also the sso.

g. http://www.guardian.co.uk/environment/2010/oct/20/spending-review-cuts-environment). In various cases this cutting of budgets has reduced

the number of sampling locations ( De Jonge et al., 2006), frequency of sampling ( Abramic et al., 2012, or required looking for cheaper assessment methods ( Lampadariou et al., 2005). We accept that all fields include the ‘law of diminishing returns’, what may be called the 80/20 rule – in the first 20% of the time studying a problem then you obtain 80% of the information required, but to obtain the remaining 20% information then requires a disproportionate amount of time and energy. However, our fear here is that rather than scientific criteria BMS-354825 cost being used to define the level of monitoring, it is economics – i.e. the ‘bean-counters’ are now dictating the science to be undertaken such that we will reach a stage where monitoring is not longer fit-for-purpose or even, paradoxically, value-for-money. Biological/ecological monitoring is often centered on measuring the community composition of an area and detecting whether that has changed, for example due to pollution of the arrival of alien and invasive species (Gray and Elliott, 2009). One of the

ways proposed for saving money is to use presence/absence of learn more an ecological component instead of Selleckchem Akt inhibitor abundance (Bates et al., 2007) and another relates to the taxonomic sufficiency i.e. the use of high taxonomic levels (e.g. family instead of species), since its first formulation by Warwick (1988). This suggests that samples could be analysed

to higher taxonomic levels, detecting the pollution effects on marine communities with similar statistical accuracy, and saving money because of the higher cost of identifying organisms at the species level (Dauvin et al., 2003 and Dimitriou et al., 2012). In this way, it is interesting to note that the analysis to family level is only cheaper if you are skilled to species level; if you do not train taxonomists (which is the current trend in all countries) then even family level identification is difficult and expensive. We are also amazed that managers are willing to spend thousands of euros/dollars on chemical analyses but then complain about biological samples (which require people with skills instead of machines) costing money. Secondly, while it has long been accepted that analytical quality assurance/quality control (AQC/QA) is required in chemistry laboratories, which may commit up to 40% of their time and budget to this, there has been resistance to adopting this in biological analyses (Elliott, 1993 and Gray and Elliott, 2009).

To reamplify Skp, forward primers were used to incorporate BglII, followed by the enhancer GAATTCATTAAAGAGGAGAAATTAACT and the periplasmic or cytoplasmic

versions of Skp. A reverse primer was designed that anneals to the entire V5 sequence and to an optimized Shine–Dalgarno (SD) sequence driving the translation initiation of FkpA. To reamplify FkpA, forward primers were designed to anneal to the C-terminal portion of V5, the optimized DNA Damage inhibitor SD, and the periplasmic or cytoplasmic versions of FkpA. A reverse primer was designed to add a HindIII-FLAG tag sequence to the C-terminal portion of FkpA. The Skp and FkpA PCR products were then gel-purified using Qiagen gel extraction kits (Valencia, CA) and used as templates for an overlap extension

PCR reaction using the external forward Skp primer and an external reverse FkpA primer. Fig. 1a illustrates the resulting chaperone inserts. Ligations of the BglII–HindIII MDV3100 manufacturer digested PCR products to the BglII–HindIII digested pAR3 vector were then transformed by electroporation into XL1-Blue cells. The final constructs were confirmed by DNA sequencing. All Fabs and scFv fragments used in this work were cloned into proprietary phagemid vectors (Schwimmer et al., 2013) harboring a triple 6His-cmyc-V5 tag, the beta lactamase gene conferring ampicillin resistance and the ColE1 origin of replication that is compatible with the p15A origin of the pAR3 vector (backbone for chaperone expressing vectors). The Fabs with kappa light chains used were: a) XPA23 (anti-IL1β, human), b) ING1 (anti-EpCAM, nearly human), c) 83-7 (anti-human insulin receptor (huINSR), murine), d) CF1 (anti-Tie-1, human), and e) BM7-2 (anti-kinase, human). We also tested the lambda light chain containing gastrin-specific Fabs C10, D1, and E6. The antigens huINSR, Tie-1-Fc,

and IL1β were purchased from R&D Systems (Minneapolis, MN). In the phagemid vector expressing the ING1 Fab in the E. coli periplasm under the influence of the lac promoter, the gene fragment encoding the M13 phage pIII protein was replaced with cytFkpA. In order to produce the tricistronic construct ( Fig. 1b), two non-amber stop codons were added following the triple detection tag 6His-cmyc-V5. The gene fragment cytFkpA was amplified by PCR from the vector pAR3-cytFkpA, together with an upstream enhancer sequence and C-terminal FLAG tag. The final construct was cloned into the modified phagemid expressing the ING1 Fab. TG1 electroporation-competent cells were co-transformed with the Fab expressing vectors that were previously described along with one of the chaperone-expressing vectors pAR3-FkpA, pAR3-Skp, pAR3-cytFkpA, pAR3-cytSkp, or the bicistronic pAR3-[Skp + FkpA], and pAR3-cyt[Skp + FkpA]. Co-expression of the Fab-expressing vectors with the empty plasmid pAR3 served as a negative control.

WH 7803 possess none of these two negative output regulators. Diversity in cyanobacterial Kai-based timing systems appears to be evident primarily regarding the central oscillator and the input components rather than on the output side of the system. It appears reasonable, that differences in behavior and metabolic characteristics may need different input pathways, and that some cyanobacterial life styles may require more robust, self-sustained oscillations than others. For at least some examples, it seems possible Venetoclax to correlate this diversity with habitat, metabolic characteristics or behavior of the organisms. UCYN-A for example, with its

reduced genome and lack of oxygen-evolving photosystem II, can also fix nitrogen during the day. Therefore, a timed regulation of this process is not needed, which could be a possible explanation for a reduced Kai system. Other Cyanobacteria in aquatic environments, for example, produce gas vesicles and might adjust their position in the water

column to efficiently absorb light and possibly to prevent predation by zooplankton (Beard et al., 2002, Damerval et al., 1989, Damerval et al., 1991, van Gremberghe et al., 2008, Walsby, 1994 and Williams, 2009). Furthermore, this feature contributes to the ability to form large surface blooms. Nodularia is one of many Cyanobacteria harboring gas vesicles that provide buoyancy. selleck It dominates late-summer cyanobacterial blooms and scums in the Baltic Sea and can be found in brackish water ecosystems throughout the world ( Voß et al., 2013). One may speculate that a real free-running, temperature-compensated circadian clock would be a useful tool in regulation of buoyancy, and that external stimuli might be too unsteady to correctly time this behavior. Variations in the timing system are not only seen between KaiABC-based

and KaiBC-based timing systems. The multiple copies of kaiB and kaiC found in some marine Cyanobacteria discussed in Section 3.3 and their lineage within the phylogeny tree suggest functions of KaiB and KaiC diverse from circadian regulation, at least selleck compound for some of them. In this respect, elucidation of roles of the homologous circadian clock proteins in marine Cyanobacteria would profoundly help to understand the evolutionary history of the Kai proteins, their impact on temporal regulation of intracellular activities and the adaptive significance of the clock. So far KaiC from MED4 represents the only clock homolog of a marine cyanobacterium for which biochemical data are present. But, taking into account the structural and biochemical information available for KaiC proteins from S. elongatus and Thermosynechococcus elongatus BP-1 the activity of KaiC proteins from further marine species can be predicted. A sequence alignment of KaiC proteins from the marine species analyzed in Table 1 and S. elongatus-KaiC ( Fig.

Contudo, embora este efeito possa em teoria acontecer após o uso de learn more corticosteroides, a evidência clínica não corrobora este efeito com o uso de corticoterapia mesmo em doses pequenas e períodos curtos. Os mecanismos hepáticos de ação da HC são dependentes de um mecanismo de regulação pré e pós-transcricional do IGF-1. A dimerização da HC, isto é, a ligação da hormona circulante ao seu recetor, ativa uma proteína citoplasmática (JAK), que posteriormente fosforila o signal transducer and activator of transcription protein 5 conhecido por STAT 5 e este segundo

mensageiro celular ativa a transcrição nuclear e síntese proteica de IGF-1. O mecanismo é autorregulado negativamente por «feed-back», com síntese quase simultânea de proteínas inibitórias GDC0449 (SOCS) que contrabalançam a síntese de IGF-1, suprimindo desta forma a expressão hepática deste IGF. O transporte sérico até aos órgãos-alvo depende de proteínas transportadoras, denominadas IGF-binding proteins (IGFBP) que existem em 5 subtipos, sendo a mais importante o IGFBP3 que transporta e aumenta a semivida do IGF-1 sérico (até 16 horas) e catalisa a sua ligação a recetores específicos no tecido ósseo.

Os outros IGFBP ligam-se ao IGF-1 com maior afinidade que os recetores periféricos, diminuindo desta forma a sua biodisponibilidade. Em situações de malnutrição, a diminuição da produção de IGF-BP3 condiciona fortemente a diminuição da ação do IGF-1 sobre o crescimento e por consequência a ação da HC. O crescimento pubertário é ainda influenciado pelas hormonas sexuais, especialmente os estrogénios, que induzem o eixo HC/IGF-1, e também pelos androgénios, que têm ação direta trófica sobre a placa de crescimento óssea10. A doença inflamatória também perturba o funcionamento da placa de crescimento por chamada de células inflamatórias. O défice de IGF-1 parece não ser o único fator causal do atraso

de crescimento. Contudo, a diminuição dos níveis de IGF-1 e IGF-BP3 séricos correlaciona-se com a diminuição do crescimento linear verificado noutras Dapagliflozin doenças inflamatórias como a artrite crónica juvenil11. Os estudos sobre o efeito da administração de HC no atraso de crescimento verificado na doença de Crohn são escassos. Numa pequena série de crianças com doença de Crohn onde foi administrada hormona de crescimento exógena, não se verificou nenhuma melhoria e, embora o número tenha sido pequeno (n = 7 casos), sugere a existência de hormonorresistência que ainda não está completamente explicada12. A resistência hepática à hormona de crescimento pode ser explicada pela diminuição da sua expressão hepática induzida por citocinas inflamatórias. Noutras situações inflamatórias, como a sépsis, a estimulação com fator de necrose tumoral alfa (TNF-α) resulta em diminuição da via da fosforilação STAT5 e consequente redução da expressão de IGF-1 induzida pela HC13.

Sowers Genevieve Sparagna Peter Sporn AS Srivastava Christodoulos Stefanadis Olga Stenina J Stuart Liou Sun Russel Taichman Andrew Talal Flora Tassone Venkat Tholakanahalli Robert F. Todd III Gregory Tsay Jan van Mourik Brian Van Ness Manual Vázquez-Carrera Catherine Verfaillie Maria F. Virella Maximilian von Eynatten Selleckchem Oligomycin A Jil Waalen John E. Wagner Xin Wang Douglas Wangensteen Theodore Warkentin Naoki Watanabe Peter Watt Babette B. Weksler Theodore Welling Tobias Welte Adam Whaley-Connell Paul White Kwong-Kwok Wong John Wood Hadi Zafarmand Peter Zage Robert Zee Walter Zidek “
“Søren Hess and Poul Flemming Høilund-Carlsen Björn

A. Blomberg and Poul Flemming Høilund-Carlsen [18F]-fluorodeoxyglucose PET (18FDG PET) imaging has emerged as a promising tool for assessment of atherosclerosis. By targeting atherosclerotic plaque glycolysis, a marker for plaque inflammation and hypoxia, 18FDG PET can assess plaque vulnerability and potentially predict click here risk of atherosclerosis-related disease, such as stroke and myocardial infarction. With excellent reproducibility, 18FDG PET can be a surrogate end point in clinical drug trials, improving trial efficiency. This article summarizes key findings in the literature, discusses limitations of 18FDG PET imaging of atherosclerosis, and reports recommendations to optimize imaging protocols.

Sandip Basu, Rakesh Kumar, and Rohit Ranade This article reviews the major treatment response evaluation guidelines in the domain of cancer imaging and how the potential of PET imaging, particularly with fluorodeoxyglucose, is increasingly explored in

this important aspect of cancer management. Certain disease-specific response criteria (such as in lymphoma) are also reviewed with emphasis on the changes made over time and the main areas of concern in PET interpretation. The major present Etofibrate clinical applications are illustrated and potential new areas are discussed with regard to clinical applications in the future. Finally, the evolving role of newer and novel PET metrics, which hold promise in treatment response evaluation, is illustrated with examples. Christina K. Speirs, Perry W. Grigsby, Jiayi Huang, Wade L. Thorstad, Parag J. Parikh, Clifford G. Robinson, and Jeffrey D. Bradley In this review, we review the literature on the use of PET in radiation treatment planning, with an emphasis on describing our institutional methodology (where applicable). This discussion is intended to provide other radiation oncologists with methodological details on the use of PET imaging for treatment planning in radiation oncology, or other oncologists with an introduction to the use of PET in planning radiation therapy. Sina Houshmand, Ali Salavati, Søren Hess, Thomas J.

24 and a skewness of −0.51. An average of 432.9 mm, or 78.6% of the total yearly precipitation, fell in the rainy season from May to September (Supplementary Table 1). It is noted that almost all the runoff generation storms occurred in the rainy season in this region (Zhu et al., 1997). Over the SSP, LSP, and SCP monitoring periods, SCH772984 nmr the mean annual precipitation was 522 mm, 524 mm, and 565 mm; the mean rainfall amount in the rainy season was 405 mm, 413.4 mm and 449.5 mm, which accounted for 77.6%, 78.9% and 79.5% of total annual precipitation, respectively (Fig. 4). The following are the supplementary data to this article. In this study, if a storm generated flows on any of those monitoring plots, it was referred to

as a runoff generation event. Flows buy AZD6244 may be present on some plots but absent on other plots in a small runoff generation rainfall event due to the difference in soil infiltration. There were 22, 25, and 59 runoff generation storm events in the SSP, LSP, and SCP monitoring periods. It is noted that the

LSP monitoring period was within the SCP monitoring period. Overall, all those runoff generation storm events ranged from 3.6 to 110 mm in event rainfall amount, 0.25–26.1 h in rainfall duration, and 1.03–62.4 mm/h in mean event intensity (Fig. 5). To determine the recurrence intervals of runoff generation storms, an empirical equation was used in this study (Eq. (1)). The equation was developed by Shanxi Bureau of Meteorology based on the long-term continuous data collected at the weather stations across the Shanxi Province. The coefficients (A, B, n) in the equation were calibrated using

the rainfall data in each region and they are varied from region to region. equation(1) logN=I×tnB24n−1Where N is recurrence interval (year); t is rainfall duration (h); I is mean rainfall intensity (mm/h); A, B and Tobramycin n are coefficients (A = 40, B = 65, and n = 0.7). The recurrence intervals of all the runoff generation storms over the study periods are shown in Fig. 5d. At slope angles of 5°, 10°, 15°, 20°, 25°, and 30°, the mean annual runoff per unit area was 42.9, 44.2, 45.4, 44.2, 44.3 and 47.2 mm on SSP, in comparison of 31.1, 24.3, 33.7, 28.8, 27.2, and 25.1 mm on LSP. Overall, the variation in runoff per unit area with slope angles was fairly limited on SSP (Fig. 6a). The highest mean annual runoff, occurring at 30°, was only 9.1% more than the lowest, occurring at 5°. On LSP, the highest mean annual runoff, occurring at 15°, was 27.8% more than the lowest, occurring at 10°. The relationship between runoff and slope angles was inconsistent between SSP and LSP. On SSP, the mean annual runoff per unit area generally showed a slight increase with slope angles. However, on LSP, the mean annual runoff reached a maximum at 15° and then decreased with slope angles. The inconsistent and complex relationship between runoff and slope angles might be ascribed to the effects of several factors on soil infiltrability.

4 years for Blacks, 16.4 years for East Asians, with Whites in the middle. The percentage of students who were sexually active was 32% for East Asians and 81% for Blacks, with Whites again between the other two. In another study, White Americans reported more sex guilt than Black Americans and that sex had a weakening effect. Blacks said they had casual intercourse more and felt less concern

about it than Whites. African descended people are over-represented in rates of sexually transmitted diseases [STDs] such as syphilis, gonorrhea, herpes, chlamydia, and HIV/AIDS (US Centers for Disease Control, 2009). Of the more than one million people living in the US with HIV/AIDS in 2007, almost half (46%) were Black. The www.selleckchem.com/products/MS-275.html Black–White difference in HIV/AIDS is found worldwide with high levels in sub-Saharan Africa, for example, Botswana (24.8%), South Africa (17.8%), Zambia (14.6%) and Zimbabwe (14.3%) this website (CIA World Factbook, 2010). The Black Caribbean is also disproportionately represented, despite limited recent contact between Africa and the Caribbean Islands. In the Caribbean, the rates approximate as high as they were in sub-Saharan Africa 20 years ago, for example, the Bahamas (3.1%), Haiti (1.9%), and Jamaica (1.7%). To slow the spread of HIV/AIDS, public health agencies give out free condoms. Condom size can affect comfort level and so whether one is used. Thus these agencies take note of penis size. The World

Health Organization Guidelines specify a 49-mm-width condom for Asia, a 52-mm-width for North America and Europe, and a 53-mm-width for Africa. China is now making its own condoms – 49 mm. Life history theory (LHT) provides a framework for understanding the allocation of bodily resources for survival, growth and reproduction. Life history traits form a continuum from “fast” (r) strategies at one end to “slow” (K) strategies at the other end. The traits include age of gestation, litter size, total number of offspring, time between births, speed of physical growth, timing of puberty, age at first birth, infant mortality, degree of parental care, brain size, longevity, mate

seeking, parenting, investing in kin and even social organization much and altruism ( MacArthur and Wilson, 1967, Pianka, 1970 and Wilson, 1975). Unlike other approaches to explain behavior, life history theory predicts the co-variation of diverse clusters of biological and behavioral traits. Traits need to be harmonized rather than work independently. They work more effectively when organized in a coordinated system, fitting together like the pieces of a puzzle. Thus, we hypothesize that the relationships reviewed between darker pigmentation, higher levels of aggression and increased sexuality, go along with multifarious other characteristics. The “fast–slow” or “r–K” scale originates in population biology, with r and K as symbols denoting rates of reproduction and death. Together they measure population density and change.