84%, p = 0.054). There was a trend toward higher approval rates from government compared to private insurance (see Table). Government and private insurers were equally likely to approve FDA-approved regimens and Sof/Sim. There was no difference in approval rates in cirrhotics or LT recipients. Overall, prior response had no impact on approval but among prior Tyrosine Kinase Inhibitor Library research buy P/NR patients, government insurers were more likely to approve the AASLD/IDSA recommended Sof/Sim compared to private insurers. Approval of FDA-approved regimens for treatment naïve and relapsers was similar regardless of insurance. CONCLUSIONS: 1) A high rate of approval for 2nd generation

DAA treatment was seen. 2) Naïve and prior relapse status, presence of cirrhosis, and transplant status did not affect approval rate. 3) Government insurance plans were more likely to approve HCV treatment and were significantly more adherent to the AASLD/IDSA guidelines for P/NR than private insurers. Approval Rates (%) Disclosures: Trametinib price The following people have nothing to disclose: Fredric D. Gordon, Amir A. Qamar, Patricia M. Hogan, Lois V. Daponte, Mary Ann Simpson BACKGROUND AND AIM: SOF-containing regimens have been approved for treatment of HCV-HIV patients. We assessed the impact of SOF in HCV-HIV patients treated with SOF and ribavirin (SOF+RBV) during Phase 3 PHOTON-1 trial. METHODS: HIV-HCV co-infected

patients were treated with 12 or 24 weeks of SOF+RBV. Matched controls from HCV mono-infected participants in FUSION and VALENCE trials. All subjects completed 4 PRO questionnaires [Chronic Liver Disease Questionnaire-HCV (CLDQ-HCV), Short Form-36 (SF-36), Functional Assessment of Chronic Illness Therapy-Fatigue (FACIT-F), and Work Productivity and Activity Index: Specific Health Problem (WPAI:SHP)]

before, during, and post-treatment. RESULTS: PHOTON-1 cohort included 223 patients (51% genotype 1, 95% receiving antiretroviral therapy). Baseline PROs were generally similar between HIV-HCV co-infected vs. HCV mono-infected patients. During treatment, moderate decrements in some PROs (up to 7.0% on a 0-100% scale for activity impairment of 上海皓元 WPAI:SHP, p=0.0027) were experienced regardless of treatment duration (p>0.05). In HIV-HCV co-infected patients with SVR-12 (N=176), most of PROs improved (by up to 12.1% for the “worry” domain of CLDQ-HCV, p<0.0001). In multivariate analysis, female gender, treatment-experienced, older age and having a history of anxiety, depression and clinically overt fatigue were the most consistent independent predictors of lower PROs (all p<0.05). Furthermore, treatment-related PRO decrements, as well as post-SVR PRO scores were similar between HIV-HCV co-infected and HCV-mono-infected patients (all p>0.05). In the multivariate analysis, co-infection with HIV was not associated with PRO impairment at any time point (all p>0.05). CONCLUSIONS: Patients with HIV-HCV treated with IFN-free SOF-based regimens have similar PROs to those with HCV mono-infection.

There was no difference in the proportion of deficiencies between elderly who reported a dental visit in the preceding year or not having seen a dentist. A quarter of the prostheses required replacement. The findings from this and the NHANES studies demonstrate that an engaged and recognized prosthodontic dental school faculty continues to be as important now as it was a generation ago. “
“Purpose: The purpose of this study was to assess the performance of an intraoral dental colorimeter. Materials and Methods: In Y27632 vivo repeatability of an intraoral colorimeter was assessed by performing color measurements of 30 individuals’ right maxillary central incisor.

Three consecutive measurements from each individual were made. In the in vitro part of the study, 25 metal-ceramic and 25 all-ceramic specimens were prepared. Five shades of metal-ceramic

and all-ceramic specimens were selected for color determination. A widely recognized in vitro colorimeter was used as the control group for the in vitro performance assessment of the in vivo colorimeter. The color differentiation capability of two colorimeters was compared with the readings obtained from ceramic specimens. ΔE values between shade groups of ceramic specimens were calculated and statistically analyzed with Student’s t-test. The repeatability of the intraoral instrument was evaluated statistically with Intraclass correlation coefficient. Results: The in vivo evaluation results showed that the overall repeatability coefficient values of L*, a*, and b* notations of the intraoral RGFP966 in vitro colorimeter were “excellent.” The color differences (ΔE) calculated between the colorimeters were significant only between shades A1-B1 for metal-ceramic specimens (p= 0.002); however, from 5 of 10 shade couples of all-ceramic specimens, the color differences obtained from the readings of the in vivo colorimeter were significantly different from that of the in vitro

colorimeter (p < 0.001). For all specimens, the differences between 上海皓元医药股份有限公司 ΔE values were within clinically acceptable limits (<3.5). Conclusions: Within the limitations of this study, the intraoral colorimeter exhibited successful in vivo repeatability; however, the color difference detection performance of the device varied depending on the translucency of the specimens. "
“When a screw fracture occurs on a cement-retained, implant-supported restoration, the abutment and restoration are completely separated from the implant’s internal connection. Traditionally, an access hole is drilled through the crown to retrieve the broken screw, and the restoration can be placed again as a screw-retained restoration. This clinical report documents a patient whose broken abutment screw was retrieved from the restoration by burning off the cement and separating from the abutment without drilling an access hole.

These may include both fertility and pregnancy issues. Maintaining contact with the medical team can benefit women approaching the menopause by preparing them psychologically for the

change and its associated symptoms. “
“Haemophilic arthropathy causes pain and a severely restricted range of motion, and results in a significant reduction in quality of life. When conservative treatments have failed, orthopaedic surgery is recommended for these patients with severe haemophilic arthropathy. However, surgery for haemophilia patients is challenging due to high complication rate such as infection, delayed wound healing and mortality. The aim of this study was to evaluate the incidence of early complications and identify preoperative risk factors of surgery for haemophilia patients. We report JNK signaling inhibitor a series of haemophilia patients undergoing elective orthopaedic surgery between 2006 and 2012. During Apoptosis Compound Library mw this period, 119 surgeries in 81 patients were

prepared and 118 surgeries in 80 patients were actually performed. Four deep bacterial infections and four delayed wound healings occurred within 6 months postoperatively. One patient died preoperatively and four patients died postoperatively. Only the presence of inhibitor was a significant risk factor for infection. We found no risk factor related to delayed wound healing. Our data revealed alkaline phosphatase, albumin, platelet, alpha-fetoprotein, presence of ascites and child classification C as predictors of perioperative mortality following elective orthopaedic surgery. Our role is to identify potential patients who present with risk factors for complications and attempt to seek the best determination of treatment strategy for these people. “
“The use of pulsed ultrasound (PUS) and low level laser therapy (LLLT) in patients with haemophilia

has been recommended for supportive treatment of acute and chronic phases of haemarthrosis but its role has not been supported by experimental evidence. The purpose of the present study was to evaluate the effect of these modalities on joint swelling, friction and biomechanical parameters of articular 上海皓元 cartilage. An experimental rabbit knee haemarthrosis model was used to test the hypothesis that LLLT and PUS favourably impacted on the biotribological and biomechanical properties of cartilage after joint bleeding. To test this, 35 male albino rabbits weighing 1.5–2 kg were used. The left knee of 30 rabbits was injected with 1 mL of fresh autologous blood two times per week for four consecutive weeks to simulate recurrent haemarthrosis; five rabbits served as non-bleeding controls. Ten rabbits were treated with PUS and 10 with LLLT and the remaining 10 were not treated. The treatments were started after 2 days and the treatment duration was planned for 5 days (sessions) in ultrasound and laser groups.

They are rapidly recruited to sites of infection and inflammation. Neutrophils phagocytose invading microbes3 and proceed to kill them by generating superoxide anions and hydrogen peroxide along with other reactive oxygen species (ROS) through activation of nicotinamide adenine dinucleotide phosphate (NADPH)-oxidase,

a process termed respiratory or oxidative burst (OB).4 The OB products are effective in eradicating invading microorganisms, but unfortunately may damage “innocent bystanders,” leading to tissue destruction, inflammation, and organ failure. Neutrophils possess receptors for the Fc region of immunoglobulin G (FcγRIII/CD16 and FcγRII/CD32) and for complement molecules such as iC3b (MAC-1/CD11b-CD18), which bind to the surface of the microbe (opsonization). Complement-opsonized particles are gently internalized within the neutrophil with Fcγ receptor ligation augmenting the process through ITF2357 cell line the extension of pseudopods which surround and engulf the microbe.3 Neutrophils are rapidly recruited to the liver in response to hepatic injury in ALF,5 and once there they become activated

by cytokines (e.g., interleukin [IL]-8 and tumor necrosis factor alpha [TNF-α]), and may contribute to further tissue damage by release of proteolytic enzymes and ROS.6 An exaggerated systemic inflammatory response (SIRS) is frequently present in ALF and increasingly it is being recognized 上海皓元 to play a key role in the pathogenesis and outcome.7 Systemic neutrophil activation with associated immune paresis is well recognized in severe sepsis, selleckchem a condition that shares many phenotypic features with ALF including microvascular dysfunction, hemodynamic instability, coagulopathy, encephalopathy,

and high levels of both proinflammatory and antiinflammatory cytokines.8 In severe sepsis excessive activation of neutrophils has been implicated in the pathogenesis of acute lung and kidney injury.9 Neutrophils might therefore serve as critical effector cells of the progressive parenchymal liver damage and MODS in ALF. There is a high incidence of bacterial and fungal infection early in the course of ALF (10) which may preclude listing for LT. ALF is also associated with an acute and often precipitous increase in plasma ammonia levels.2 A recent study has shown that neutrophils exposed to ammonia have reduced phagocytic activity of opsonized E. coli and high spontaneous production of ROS, suggesting a direct toxic effect of ammonia on neutrophils.11 Neutrophil dysfunction has also been previously reported in ALF with reduced complement expression,12 impaired neutrophil adhesion,13 decreased production of ROS,14 and decreased neutrophil phagocytosis and intracellular killing. We postulate that circulating neutrophil dysfunction is present in ALF and may add value as a prognostic marker of severity and outcome.

Although fatigue was the symptom with the highest overall load in PBC, the symptom set with the greatest impact (compared to controls) were autonomic symptoms. These symptoms were prevalent in the PBC population (confirming earlier, smaller studies) but largely absent in age- and sex-matched controls. The etiology of autonomic dysfunction in PBC is unclear; there may be both central and peripheral effects. In the central model brain injury, perhaps arising as a consequence of inflammatory processes occurring as INCB024360 cost a result of cholestasis inflammation (a model supported by animal modeling data for cholestasis25),

would affect autonomic regulating areas of the brain, leading to secondary peripheral autonomic effects. In the peripheral model vasomotor changes associated with liver disease and/or specific cardiac dysfunction associated with cardiac muscle abnormality in PBC26, 27 would give rise to processes mimicking central autonomic dysfunction peripherally. These models are, of course, not exclusive. Evidence in favor of an organic CNS process in PBC comes from brain imaging data and neurophysiology studies which suggest the presence of

organic brain change.24, 28 In the current study autonomic symptoms associated strongly with cognitive symptoms, fatigue, and with sleep disturbance. The strong associations between autonomic dysfunction, fatigue, problems with cognition, and problems with sleep regulation all provide further support for at least some organic CNS element underpinning the symptom complex in PBC. Again, further work in this area is warranted.

Ultimately the goal of this work is this website to improve the QOL of PBC patients. Although fatigue represents a major burden for patients, the impact that it has on their lives is itself complex. Although the presence of fatigue shows strong overall association with QOL, there was a clear-cut group of patients (nearly 300 in the national cohort) who had significant fatigue but whose perceived QOL remained good. A striking contrast was seen between this group of patients and the larger group of patients with severe medchemexpress fatigue who perceived their QOL as being poor, and this related to significant symptoms of social function (a symptom domain that showed the strongest overall association with QOL). Whereas 89% of patients with severe fatigue and poor QOL showed social dysfunction symptoms, only 11% of patients with severe fatigue and good QOL showed social impairment. This observation, together with data linking social function symptoms to QOL, suggests that, whereas fatigue is an important symptom for putting patients at risk of impaired QOL, ultimately this can be modified by the extent to which they maintain social contacts and links. This observation builds on previous findings to suggest that coping strategies are important for perception of life quality in PBC.

Over the subsequent weeks the patient spontaneously recovered and was completely asymptomatic. Cholestasis with normal gamma glutamyl transferase is a key feature of functional deficiencies in the gene ATP8B1, encoding a P-type ATPase1 or ABCB11, which encodes the bile salt export pump (BSEP), a liver specific adenosine triphosphate (ATP)-binding cassette transporter.2 Depending on their Y-27632 mouse localization, mutations in ABCB11 may result in promoter changes affecting transcription or new splice acceptor sites leading to nonsense mediated decay of the messenger RNA.3 As a result the protein can be quantitatively or functionally insufficient. Sequence analysis

in this patient revealed a heterozygote ABCB11 mutation c.221T>C. This nucleotide change results in an amino acid change p.Ile74Arg in the first transmembrane domain of the ABCB11 protein. Immunohistochemical staining of the liver biopsy showed a normal (canalicular) expression of BSEP (Fig. 1, Panel 4). However, there was a gradual decrease from zone 1 to zone 3 of the liver lobule with a very low

expression of BSEP in the zone around the central vein (Fig. 1, Panel 4, arrow). In contrast, we observed in a control patient a homogeneous distribution of BSEP throughout the liver parenchyma, including the pericentral area (Fig. 1, Panel 5, arrow). Two years later the patient continued to show marginally elevated levels of serum bile acids (33 μmol/L) and alkaline phosphatase (110 U/L), indicating the persistence

of a mild cholestasis. ABCB11 deficiency has been described in association with numerous LY2157299 in vitro mutations and represents a clinical continuum from very mild to progressive forms of cholestasis, including MCE benign recurrent intrahepatic cholestasis type 2, intrahepatic cholestasis of pregnancy, and progressive familial cholestasis 2. This patient had biliary stones, a distinguishing feature of ABCB11 deficiency, probably due to the low bile salt concentration secondary to impaired BSEP function. The attack of cholestasis in this patient was preceded by nausea and vomiting for a few days. Episodes of minor infections or drugs taken shortly before the cholestatic event are considered possible trigger factors in patients carrying mutations in the ABCB11 gene and may explain the intermittent character of intrahepatic cholestasis.4 In our case sequence analysis revealed only one heterozygous single nucleotide mutation, but we cannot exclude the possibility that other mutations have been missed. The immunohistochemical findings suggest that the mutation identified here may predispose patients to cholestasis through a regulatory mechanism of BSEP not at the canalicular, but at the lobular level. Further investigation will be needed to confirm these findings and to understand the role of BSEP in the different liver lobule zones.

The primer sets for real-time polymerase chain reaction (PCR) were: Granzyme A (F) 5′ TATCCATGCTATGACCCAGCC 3′; Granzyme A (R) 5′ TTCACATCATCCCCCTTTTTAGG 3′; Perforin (F): 5′ AGGAGCTGGGCAGAAGGCCAAGA 3′; and Perforin (R): 5′ CACCATAGAGGGCTCAAGGGAA GG 3′. These two primers were synthesized by Sigma Life Science (St. Louis, MO). FoxP3 (PPH00029B; SABiosciences),

interleukin (IL)-4 (PPH00565A; SABiosciences), IL-10 (PPH00572B; SA Biosciences), IL-21 (PPH01684A; SABiosciences), IL-22 (PPH01079B; SABiosciences), TGF-β (PPH00508A; SABiosciences), and tumor necrosis factor-α (TNF-α; PPH00341E; SABiosciences) primer sets were purchased from SABiosciences. Levels of plasma IgG, IgM, and IgA were determined using the human IMMUNO-TEK IgG, IgM, and IgA enzyme-linked immunosorbent assay (ELISA) kit (ZeptoMetrix Opaganib molecular weight Corp., Buffalo,

NY). Plasma levels and culture supernatant levels of anti–PDC-E2 were quantified using an ELISA. Briefly, 96-well ELISA plates were coated with purified recombinant PDC-E2 at 5 mg/mL in carbonate buffer (pH 9.6) at 4°C overnight, washed five times with Tris-buffered saline Tween-20 (TBS-T), and blocked with 5% skim milk in TBS for 30 minutes. Then 100 μL of the samples was added to individual wells of this microtiter plate for 1 hour at room temperature (RT), and the plates were rewashed. Then 100 μL of horseradish peroxidase (HRP)-conjugated anti-human immunoglobulin (A+M+G) (H+L) (1:2000) this website or IgA (1:2000) or IgM (1:2000) or IgG (1:2000) (Zymed, San Francisco, CA) was added to each well for 1 hour at RT, and the microtiter wells were rewashed. Immunoreactivity was detected by measuring the optical density (O.D.) at 450 nm after exposure for 15 minutes to 100 μL of TMB peroxidase substrate (KPL, Gaithersburg, MD). Previously calibrated positive and negative standards were included with each

assay Values are expressed as the mean ± SEM. Statistical analysis was performed using a two-tailed Wilcoxon matched pairs test. Values with P < 0.05 were considered statistically significant. Six patients were enrolled and all received at least one infusion of rituximab (Table 1). Two patients received only 1 infusion of rituximab due to reactivation of Varicella zoster (patient 1) medchemexpress and an upper respiratory infection (patient 4), both of which resolved without complication. All patients completed 52 weeks of follow-up and otherwise tolerated the treatment well with no serious adverse events observed. IgA, IgM, and IgG levels after rituximab treatment are shown in Fig. 1. After B-cell depletion by rituximab treatment, plasma levels of IgA, IgM, and IgG decreased. This decrease was sustained until week 24. At week 36 immunoglobulin levels began to recover. The largest decrease was seen in IgM levels: at week 24 IgM levels had deceased by almost 50% (0 weeks: 1.64 ± 0.20 mg/mL; 24 weeks: 0.88 ± 0.14 mg/mL). Plasma reactivity against PDC-E2 (AMA) was positive in all patients before rituximab treatment.

This suggests that the expression of a CC-like trait in HCC might be attributable, at least in part, to the existence of intratumoral fibrous stroma in HCC (i.e., S-HCC). Next, we compared the disease-free survival (DFS) of those three tumor types. Follow-up data were available in all cases, with an average duration of 29 ± 24 months (mean ± standard deviation). Consistent with a previous report, which showed poorer clinical outcomes for CC-like HCC,5 the DFS rate was the highest in HCCs and the lowest

in CCs, with S-HCCs falling in between (P < 0.001) (Fig. 2D). A comparison of DFS between S-HCCs and HCCs showed that the difference was not significant, which may have been a result of the small sample size. However, DFS was significantly worse in S-HCCs than in HCCs when large tumors Protein Tyrosine Kinase inhibitor (≥5 cm) were analyzed separately (P = 0.038; Fig. 2E). A recent study has shown the aggressive pathological features of S-HCC, which has less tumor-capsule formation and hypervascularity than conventional HCC, supporting our findings.17 CC-like HCCs have shown the expression of stem-cell–like traits, implying their cellular origin from liver SPCs.5 Similarly, S-HCCs have also been reported to express several SPC markers, such as K7,

K19, and EpCAM.8, 10 With respect to this finding, we further evaluated the expression of stem-cell–like traits in S-HCC. The expression of differential markers, including EpCAM, K7, K19, CD56, AFP, and HepPar1, was evaluated using IHC stain. Strikingly, most cases of S-HCCs (13 of 14; 93%) were immunostained by at least one of the K19, Crizotinib ic50 EpCAM, and CD56 markers (Fig. 3A-D). In addition, the topographical expression patterns of K19/EpCAM (liver SPC markers) and HepPar1 (a hepatocyte marker) were evaluated by double IHC stain. In most S-HCCs (8 of 11 double-positive cases; 73%), K19 and/or EpCAM protein was expressed in the small peripheral tumor cells adjacent to the fibrous stroma, whereas HepPar1 protein was expressed mainly in the eosinophilic polygonal tumor cells with ample cytoplasm at the center of

the tumor-cell nests (Fig. 3D). These findings may indicate that the expression of CC-like and stem-cell–like traits is closely related to the fibrous stromal component in S-HCC. The differential expression of SPC markers was further confirmed at both the mRNA and protein 上海皓元医药股份有限公司 levels. Messenger RNA (mRNA) levels of EpCAM, CD133, K19, Oct3/4, and cMET were significantly higher in S-HCCs than in HCCs (P < 0.05), whereas those of CD133 and K19 were lower in S-HCCs than in CCs (P < 0.05) (Fig. 3E-I; Supporting Table 3). The expression of those SPC markers correlated well with one another, indicating the modular coexpression of SPC markers (Fig. 3J; Supporting Fig. 1A-E). Similarly, protein expression levels of EpCAM, K19, K7, CD56, and AFP were more prevalent in S-HCCs than in HCCs, whereas HepPar1 was less prevalent in S-HCCs (Fig. 3K-P).

50% of patients with dyspepsia presenting for endoscopy in NZ will have no mucosal abnormality identified. National Dyspepsia Guidelines assist in management of patients. Guidelines exist for undifferentiated dyspepsia, Gastro-oesophageal Reflux Disease (GORD), H. pylori, peptic ulcer, NSAID’s and gastrointestinal complications. Irritable Bowel Syndrome (IBS) is reported Everolimus clinical trial by 21% of adults. Symptoms were more than twice as frequent and severe in females than males. Access to colonoscopy for investigation of bowel symptoms is limited in NZ and priority is given to patients with “alarm features”. Non-invasive markers of

inflammation, such as faecal calprotectin, are being used to differentiate the patient with functional diarrhoea from inflammatory bowel disease. Treatment for irritable bowel symptoms is targeted to the predominant symptom. Conclusions:  Functional gastrointestinal disorders are common in New Zealand. There GSK1120212 supplier is increasing

awareness of dietary management for functional bowel symptoms. “
“Liver X receptor (LXR) activation stimulates triglyceride (TG) accumulation in the liver. Several lines of evidence indicate that estradiol-17β (E2) reduces TG levels in the liver; however, the molecular mechanism underlying the E2 effect remains unclear. Here, we show that administration of E2 attenuated sterol regulatory element-binding protein (SREBP)-1 expression and TG accumulation induced by LXR activation in mouse liver. In estrogen receptor alpha (ERα) knockout (KO) and liver-specific ERα KO mice, E2 did not affect SREBP-1 expression or TG levels. Molecular analysis revealed that ERα is recruited to the SREBP-1c promoter through direct binding to LXR and inhibits coactivator recruitment to LXR in an E2-dependent manner.

Our findings demonstrate the existence of a novel liver-dependent mechanism controlling TG accumulation through the nonclassical ER/LXR pathway. To confirm that a nonclassical ER/LXR pathway MCE regulates ERα-dependent inhibition of LXR activation, we screened ERα ligands that were able to repress LXR activation without enhancing ERα transcriptional activity, and, as a result, we identified the phytoestrogen, phloretin. In mice, phloretin showed no estrogenic activity; however, it did reduce SREBP-1 expression and TG levels in liver of mice fed a high-fat diet to an extent similar to that of E2. Conclusion: We propose that ER ligands reduce TG levels in the liver by inhibiting LXR activation through a nonclassical pathway. Our results also indicate that the effects of ER on TG accumulation can be distinguished from its estrogenic effects by a specific ER ligand. (Hepatology 2014;59:1791–1802) “
“Alcoholic liver disease (ALD) features increased hepatic exposure to bacterial lipopolysaccharide (LPS). Toll-like receptor-4 (TLR4) recognizes LPS and activates signaling pathways depending on MyD88 or TRIF adaptors. We previously showed that MyD88 is dispensable in ALD.

We diagnosed autoimmune fulminant liver failure based on the criteria, and discussed the etiology of fulminant hepatitis (FH) and late onset hepatic failure (LOHF), and the characteristics of autoimmune fulminant liver failure. Methods:  We investigated the etiology of 95 consecutive adult patients with FH or LOHF admitted to our liver unit between 1990 and 2009. Clinical and biochemical features, therapies and outcomes were examined in patients with AIH after 2000. Results:  Of 95 patients, 85 were FH and 10 LOHF. The

etiology was due to viral infections in 51.6% (hepatitis A virus in 7.4%, hepatitis B virus in 43.2% and hepatitis E virus in 1.1%), Selleckchem DAPT AIH in 15.8%, drug allergy-induced in 12.6%, and unknown causes in 20.0%. The rate of patients with AIH increased significantly between 2000 and 2009 compared to the rate between 1990 and 1999 (P = 0.002). In recovered patients with AIH without

transplantation after 2000, coma grade was lower, alanine aminotransferase level, prothrombin time activity and alfa-fetoprotein level were higher than in the others with statistical significance. Conclusion:  AIH is not a rare cause of FH and LOHF, and the number of patients with unknown causes would surely decrease in concert with Selleck ABT-888 the precise diagnosis of AIH. “
“Nonalcoholic fatty liver disease (NAFLD) is characterized by triglyceride (TG) accumulation and endoplasmic reticulum (ER) stress. Because fatty 上海皓元医药股份有限公司 acids (FAs) may trigger ER stress, we hypothesized that the absence of adipose triglyceride lipase (ATGL/PNPLA2)–the main enzyme for intracellular lipolysis, releasing FAs, and closest homolog to adiponutrin (PNPLA3) recently implicated in the pathogenesis of NAFLD–protects against hepatic ER stress. Wild-type (WT) and ATGL knockout (KO) mice were challenged with tunicamycin (TM) to induce ER stress. Serum biochemistry, hepatic TG and FA profiles, liver histology, and gene expression for markers of hepatic lipid

metabolism, ER stress, and inflammation were explored. Moreover, cell-culture experiments were performed in Hepa1.6 cells after the knockdown of ATGL before FA and TM treatment. TM increased hepatic TG accumulation in ATGL KO, but not in WT, mice. Lipogenesis and β-oxidation were repressed at the gene-expression level (sterol regulatory element-binding transcription factor 1c, fatty acid synthase, acetyl coenzyme A carboxylase 2, and carnitine palmitoyltransferase 1 alpha) in both WT and ATGL KO mice. Genes for very-low-density lipoprotein (VLDL) synthesis (microsomal triglyceride transfer protein and apolipoprotein B) were down-regulated by TM in WT and even more in ATGL KO mice, which displayed strongly reduced serum VLDL cholesterol levels.